ID: 1020461996

View in Genome Browser
Species Human (GRCh38)
Location 7:8436703-8436725
Sequence GCACTCCCGCAGCCCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020461996_1020462003 6 Left 1020461996 7:8436703-8436725 CCCATCCTGGGCTGCGGGAGTGC 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1020462003 7:8436732-8436754 GGCTCGCTATGTTCTGTCTAGGG 0: 1
1: 0
2: 1
3: 3
4: 45
1020461996_1020462005 12 Left 1020461996 7:8436703-8436725 CCCATCCTGGGCTGCGGGAGTGC 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1020462005 7:8436738-8436760 CTATGTTCTGTCTAGGGGTGAGG No data
1020461996_1020462002 5 Left 1020461996 7:8436703-8436725 CCCATCCTGGGCTGCGGGAGTGC 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1020462002 7:8436731-8436753 GGGCTCGCTATGTTCTGTCTAGG 0: 1
1: 0
2: 0
3: 4
4: 52
1020461996_1020462004 7 Left 1020461996 7:8436703-8436725 CCCATCCTGGGCTGCGGGAGTGC 0: 1
1: 0
2: 0
3: 6
4: 164
Right 1020462004 7:8436733-8436755 GCTCGCTATGTTCTGTCTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020461996 Original CRISPR GCACTCCCGCAGCCCAGGAT GGG (reversed) Intronic
900094720 1:935696-935718 GCACTCCCTGTGCCCAGGCTGGG + Intronic
900319015 1:2073336-2073358 ACTGTCCCGCAGCCCAGGAACGG - Intronic
900417796 1:2543071-2543093 GCACCCCCACAGCCATGGATGGG + Intergenic
904810325 1:33159616-33159638 CCACTCCCACTGCCCAGCATGGG + Intronic
905726169 1:40253706-40253728 GCACTCCGGCAGCCCAAGGCGGG - Intergenic
909344618 1:74571393-74571415 GCACTCCAGGAGCCCTGGAGCGG - Exonic
911253298 1:95605057-95605079 GGACTCCCTCATCCCAGGACAGG + Intergenic
912964518 1:114226343-114226365 GCAGTCACTGAGCCCAGGATGGG + Intergenic
917517715 1:175721947-175721969 GCAGTCCAGCAGCTCATGATTGG - Intronic
917962759 1:180157454-180157476 GTACTCACACAGCCCAGGGTGGG - Intronic
917999216 1:180475629-180475651 GCACTTCGGGAGGCCAGGATGGG - Intronic
921292367 1:213670612-213670634 ACCCTCCCCCAGGCCAGGATAGG + Intergenic
923162476 1:231327660-231327682 GCACTCACGGAGGCCAAGATGGG - Intergenic
1064226654 10:13491798-13491820 GAACTCCCGCAGGCCTGTATAGG - Intronic
1066516427 10:36165909-36165931 GCACTGCTGCACCCCAGGCTGGG + Intergenic
1067193062 10:44088794-44088816 GCACTCCCACAGCACAGCACAGG + Intergenic
1068054251 10:51991528-51991550 CCACTCCCCCAGCCCATGACAGG + Intronic
1069701044 10:70426303-70426325 GCACTCCAGCACCCCAGCCTGGG - Exonic
1070552872 10:77504630-77504652 GCACTACTGCAGTCCAGCATGGG - Intronic
1070642105 10:78177653-78177675 GCCCGCCCACAGCCCAGCATGGG + Intergenic
1070772039 10:79088245-79088267 GCATTGCCGCTGCCCAGGCTTGG + Intronic
1070927253 10:80233327-80233349 TCACTCTTGTAGCCCAGGATGGG + Intergenic
1073777920 10:106806759-106806781 GCACTCCAGGAGGCCAGGGTGGG - Intronic
1075065247 10:119285002-119285024 ACACTCCCGGAGCCCAGAACAGG + Intronic
1077201090 11:1307997-1308019 GCCCTCGCGCAGCCCAGTACTGG - Intronic
1077404608 11:2377491-2377513 GCCCGCCCGCCGCCCAGGACCGG + Exonic
1078087410 11:8242561-8242583 TGGCTCCAGCAGCCCAGGATGGG - Intronic
1080326135 11:31075892-31075914 GCACTCCAGCACTCCAGTATGGG - Intronic
1083272630 11:61580096-61580118 GCCCTCCCCCACCCCAGGACGGG + Intronic
1083434323 11:62632354-62632376 GCATTCCGTCAGCCCAGAATAGG + Intronic
1084410520 11:69003798-69003820 GCACACCAGGAACCCAGGATGGG + Intergenic
1088506562 11:110533077-110533099 GCACTACCGCACCCCAGCCTGGG + Intergenic
1089457686 11:118634906-118634928 GCCCTCCCGCCGACCAGGAGAGG + Intronic
1089536024 11:119161263-119161285 CCACTCCCAGAGCCCAGGCTGGG - Exonic
1091787930 12:3254169-3254191 TCACTCCTGCAGCACAGGCTGGG + Intronic
1101411647 12:104473662-104473684 CCTCTCCCACAGCCCAGGAAGGG - Intronic
1103451770 12:121034220-121034242 TCACTCCCGTTGCCCAGGCTGGG + Intronic
1103800296 12:123533565-123533587 GCCCGCCCGCGGCCCAGGCTGGG - Exonic
1109733944 13:66456302-66456324 GCACTGCCGCACTCCAGGCTGGG - Intronic
1113818302 13:113191278-113191300 ACACTTCCGGAGGCCAGGATGGG - Intronic
1117813504 14:59573859-59573881 GCACTCCGGGAGGCCAGGATGGG - Intronic
1120915991 14:89710914-89710936 GCACTCCCTCAGCTGAGGTTGGG + Intergenic
1120929302 14:89832276-89832298 GCACTCCAGCACTCCAGCATGGG + Intronic
1122559262 14:102600119-102600141 GCACTCCAGCACCCCAGCCTGGG - Intronic
1122804671 14:104250393-104250415 GCACTCCAGCTGCCCAGGTGGGG - Intergenic
1124055161 15:26235397-26235419 GCACTACAGCAGCCAGGGATGGG + Intergenic
1125725710 15:41867156-41867178 GCCCTGCCCCAGCCCAGGGTGGG - Intronic
1126486509 15:49187518-49187540 GCTCCCCCTAAGCCCAGGATTGG + Intronic
1129113906 15:73354261-73354283 GCAGGACCTCAGCCCAGGATGGG - Intronic
1131389662 15:92036496-92036518 GCAATGCCGCTGCCCAGGGTGGG - Intronic
1132385372 15:101396685-101396707 GCACTCACTCAGCCCAGCCTTGG + Intronic
1132976021 16:2711579-2711601 GCACTCCTCCAGCCCAGGGGTGG - Intergenic
1133950034 16:10384000-10384022 GCACTACTGCACCCCAGCATGGG - Intronic
1136284276 16:29232137-29232159 GCAGTCCTGCAGCCCTGGAGTGG + Intergenic
1136633825 16:31506746-31506768 GCACTCCTGCATCCCAGCCTGGG + Intronic
1137492317 16:48943534-48943556 GCTCTCCAGCAGCCTGGGATTGG - Intergenic
1141534915 16:84672612-84672634 GCAGGCCCCCAGCCCAGGAGTGG - Intergenic
1141898956 16:86977582-86977604 GGACGCCATCAGCCCAGGATTGG + Intergenic
1142089310 16:88201643-88201665 GCAGTCCTGCAGCCCTGGAGTGG + Intergenic
1145062847 17:19743562-19743584 TCACTCACCCAGCCCAGGGTGGG + Intronic
1148127436 17:45244083-45244105 TCCCTGCCGCAGCCCAGGCTGGG - Intronic
1148479894 17:47953236-47953258 GCGCTCCCTAAGCCAAGGATGGG + Exonic
1149772235 17:59331464-59331486 GCTCTCCCCTAGCCCAGGCTGGG + Intergenic
1150276622 17:63902117-63902139 GCACTCCAGAAGCCCAGGTCAGG - Intergenic
1151679761 17:75617087-75617109 GCTGTCCCCCAGCCCAGGAAAGG + Intergenic
1152360572 17:79831466-79831488 GCACTCCCGCAGAACAGGGAAGG - Intergenic
1152697631 17:81804706-81804728 GCACCGGCGCGGCCCAGGATGGG + Intronic
1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG + Intronic
1153701139 18:7694467-7694489 GCACTACCGCAGTCCAGCCTGGG - Intronic
1155333893 18:24745763-24745785 GCACGCCCACAGCCCAGGTGGGG - Intergenic
1155820496 18:30369368-30369390 GCACTCCTGCACCCCAGCCTGGG + Intergenic
1156893686 18:42218323-42218345 GCACTCCAGCACTCCAGCATGGG + Intergenic
1160735080 19:658713-658735 CCACTGCCTCAGCCCAGGCTGGG + Intronic
1161144353 19:2668641-2668663 GCCCTCCTCCAGCCCAGGAGCGG - Intronic
1161277168 19:3425003-3425025 GCACTGGCCCAGCCCAGGACTGG + Intronic
1164527374 19:29022140-29022162 GCACACCCGCGGCCCAGCACAGG - Intergenic
1164594869 19:29526211-29526233 GCACTCCCTCGGCCAGGGATGGG + Intergenic
1166641829 19:44500285-44500307 GCTGGCCCGCAGCCCAGGCTGGG + Exonic
929436507 2:41932578-41932600 TCCCTCACGCAGCCAAGGATGGG - Intergenic
929882918 2:45852885-45852907 TGACTCAGGCAGCCCAGGATGGG + Intronic
930461420 2:51682761-51682783 GCACTACTGCACTCCAGGATGGG + Intergenic
933699582 2:85244932-85244954 GCATTCCTGCAGCCAAGGAGGGG + Intronic
933833914 2:86231095-86231117 GCTCTACTGCAGCCCAGCATGGG + Intronic
934087960 2:88525915-88525937 GCAGTCCCAAAGCCCAGGACAGG - Intronic
936092565 2:109510708-109510730 GCCCTTCCCCAGCCCAGGCTGGG - Intergenic
936713536 2:115161178-115161200 GGACGCCCGCTGCCCCGGATCGG + Intronic
945649093 2:212537877-212537899 GCACTCCGGCTGCCCGGGCTGGG + Intronic
948502814 2:238407289-238407311 GCCCTCCTGCAGCCCAGCCTAGG + Intergenic
1170889262 20:20365005-20365027 GCATCCCCGCACACCAGGATAGG + Intergenic
1171501062 20:25593646-25593668 GCACTCCTGTTGCCCAGGCTGGG - Intergenic
1172093830 20:32451080-32451102 GGTCTCCTGCAGCCAAGGATGGG + Intronic
1173398751 20:42705160-42705182 GCACTACTGCACCCCAGCATGGG + Intronic
1173838973 20:46144632-46144654 GCATTCCTGCAGCCCAGTGTGGG - Intergenic
1173847174 20:46195572-46195594 GCACTCCCGCCTCCCAGTGTTGG + Intronic
1175217738 20:57400390-57400412 GCTCTGCCACAGCCCAGGAGAGG - Intronic
1177638699 21:23818667-23818689 GCACTCCAGCACTCCAGGCTGGG + Intergenic
1179002517 21:37476493-37476515 GCACTCCACCAGCCCAAGAAAGG + Intronic
1179319697 21:40278484-40278506 GCACTCTCGGAGACCAGGGTGGG + Intronic
1179798228 21:43798136-43798158 GCACTGGCTCAGCCCAGGACAGG - Intronic
1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG + Exonic
1183299568 22:37052177-37052199 GCTCTCCAGCCGCCCCGGATCGG + Intronic
1183333281 22:37232609-37232631 GCACTCCCTCAGCCCTGCATTGG - Intronic
1183484595 22:38082308-38082330 GCAGCCCCGCCTCCCAGGATGGG + Intronic
1185380982 22:50507489-50507511 GCACTCACGCAGTCCGGGGTTGG - Intronic
950581258 3:13863809-13863831 GCACTCTCACAGCCCTAGATGGG + Intronic
950651555 3:14410443-14410465 ACACCCCCAGAGCCCAGGATGGG + Intronic
951958984 3:28293622-28293644 ACACTACTGCACCCCAGGATAGG - Intronic
954251320 3:49369698-49369720 GCACTCCAGCACTCCAGCATGGG + Intronic
954677442 3:52323680-52323702 GCACTCCAGGAGCACAGGAGTGG - Intronic
961040940 3:123677582-123677604 GCACTCCTCCAGCCCAGAGTGGG - Intronic
962463938 3:135639480-135639502 GGACTGCTGCAGCCCAGGGTGGG - Intergenic
962749898 3:138426133-138426155 GCACTACTGCACCCCAGGCTGGG + Intergenic
965123041 3:164588401-164588423 GCACTCCGGGAGACCAAGATGGG + Intergenic
966201123 3:177360155-177360177 GCACTCCGGCTGCCCAAGAAAGG + Intergenic
966712162 3:182981232-182981254 GGACTCCCGCAGCCCGGCCTTGG - Intronic
966768498 3:183483243-183483265 GCACTTTGGCAGGCCAGGATGGG - Intergenic
968843623 4:3026709-3026731 GCTCTCCCGCCTCCCAGGGTGGG + Intronic
969061691 4:4440512-4440534 CCTTTCCCACAGCCCAGGATGGG - Intronic
977176555 4:93827391-93827413 GCACTCCCGCGCCCCAGGGGCGG + Intergenic
979903012 4:126247255-126247277 GCACTCCCGCACTCCAGCCTGGG + Intergenic
983650929 4:170035607-170035629 GCAAGCCCGCAGCCCATGCTTGG - Intergenic
984972549 4:185203939-185203961 GCACTCCCGCGGCCCTGAACGGG + Exonic
985347656 4:189023588-189023610 GCACTCCAGCAGGCCAAGGTGGG + Intergenic
985773416 5:1826943-1826965 GCTCTCCCGCGGCCCAGCCTCGG + Intergenic
989408176 5:41085721-41085743 GCACCCCCGCACCCCAGCCTGGG - Intergenic
993386562 5:87268594-87268616 GGTCTCCACCAGCCCAGGATAGG - Exonic
1002460208 5:179369556-179369578 CCCCTCCCCCAGCCCAGGAACGG - Intergenic
1002575380 5:180171112-180171134 GCCTTCCCCCAGCCCAGGAGTGG + Intronic
1003125457 6:3352064-3352086 GCACTCCAGCAGCCCTGCCTGGG - Intronic
1004969015 6:20888123-20888145 GCATTCCCGCACCCCATGACAGG + Intronic
1009898175 6:69778939-69778961 GCACTTCGGAAGGCCAGGATGGG + Intronic
1011659476 6:89581832-89581854 GCACTGCAGCAGCCCTGCATGGG - Intronic
1013463836 6:110400095-110400117 GCAGGCCCGCAGCCCAGGACGGG + Intronic
1014630462 6:123783270-123783292 GCACTCCAGCACTCCAGCATGGG - Intergenic
1015502915 6:133952354-133952376 GGACTCAGGCAGCCCGGGATAGG - Intronic
1015765488 6:136711621-136711643 GCACTACTGCACCCCAGGCTGGG + Intronic
1016373006 6:143393783-143393805 GCACTCCAGCACTCCAGCATAGG - Intergenic
1016714208 6:147204498-147204520 GCTCCCCCGCAGCCCGGGAGGGG - Intronic
1018027806 6:159819378-159819400 GCACTCCAGGACCCCAGGACAGG - Intronic
1019496365 7:1342272-1342294 GGACTCCCCCAGCCCAGGGAAGG - Intergenic
1020461996 7:8436703-8436725 GCACTCCCGCAGCCCAGGATGGG - Intronic
1021531366 7:21649698-21649720 GCACTCCAGCACTCCAGCATGGG - Intronic
1026486826 7:70829232-70829254 GCACCCCCGCAACCAAGGCTTGG + Intergenic
1026678156 7:72445775-72445797 GCAATCCCCCAGCCAAGGATGGG - Intronic
1026683862 7:72491524-72491546 GCACTACTGCAGCCCAGCCTGGG + Intergenic
1026909740 7:74084763-74084785 GGACTCCCCCAGCCTAGGACAGG + Intronic
1027374252 7:77535520-77535542 TCACTCCCGTCGCCCAGGTTGGG + Intergenic
1031980884 7:128123581-128123603 GCTCTCCCGCAGCCCAGCCCTGG - Intergenic
1032029151 7:128467913-128467935 GCACTACTGCAGTCCAGGTTAGG + Intergenic
1034422360 7:150996387-150996409 GCACTCCCTCGACCCAGGATGGG + Exonic
1036066828 8:5390093-5390115 GCACTTTGGAAGCCCAGGATGGG + Intergenic
1036140407 8:6202286-6202308 GCACCCCCAGAGCCCAGGAGGGG - Intergenic
1037059061 8:14483526-14483548 GCACTCCTGCATTCCAGGCTAGG + Intronic
1037798051 8:22013287-22013309 GCACTCTGGGAGGCCAGGATAGG + Intergenic
1038644630 8:29351506-29351528 TCCCGCCCGAAGCCCAGGATCGG + Intergenic
1041696854 8:60744928-60744950 CCACTCCCTCAGCCCAGCTTAGG - Intronic
1046444953 8:114306399-114306421 GCACTCCCACAGACCAGACTGGG + Intergenic
1046766311 8:118074024-118074046 CCACTCCCGCAGCACAAGAGCGG + Intronic
1056732353 9:89177649-89177671 GGACCCCCGCTGCCCAGGGTTGG + Intronic
1057913671 9:99039464-99039486 GCACTACTGCACCCCAGGCTGGG + Intronic
1061371686 9:130201058-130201080 GCAGTCCAGCTGCTCAGGATGGG + Intronic
1062167271 9:135114173-135114195 GCACTCCAGCACTCCAGCATGGG - Intronic
1062678360 9:137761983-137762005 GCCCTGCCCCAGCCCCGGATGGG - Intronic
1189277365 X:39796862-39796884 GGACCCCCGCTGCCCATGATGGG + Intergenic
1192495707 X:71615633-71615655 GCACTCCAGCAGCTCAGGACAGG - Intergenic
1194220915 X:91189782-91189804 GCACTCCTGCACGCCAGGGTGGG + Intergenic
1196859748 X:120015793-120015815 GCACTCACCCCGCCCAGGGTGGG - Intergenic
1197796667 X:130305516-130305538 GCACTCCTGCAGCCAGGGTTAGG - Intergenic
1200557420 Y:4653526-4653548 GCACTCCTGCACGCCAGGGTGGG + Intergenic
1201787312 Y:17799322-17799344 ACCCTCCTCCAGCCCAGGATTGG - Intergenic
1201814241 Y:18106666-18106688 ACCCTCCTCCAGCCCAGGATTGG + Intergenic