ID: 1020462052 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:8437112-8437134 |
| Sequence | CAGGACACCTTGGGGTAAAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1020462040_1020462052 | 28 | Left | 1020462040 | 7:8437061-8437083 | CCGTAGCAGCCGCGGACGCCAGA | 0: 1 1: 0 2: 0 3: 4 4: 45 |
||
| Right | 1020462052 | 7:8437112-8437134 | CAGGACACCTTGGGGTAAACAGG | No data | ||||
| 1020462043_1020462052 | 19 | Left | 1020462043 | 7:8437070-8437092 | CCGCGGACGCCAGAGGGCGCTGC | 0: 1 1: 0 2: 3 3: 10 4: 110 |
||
| Right | 1020462052 | 7:8437112-8437134 | CAGGACACCTTGGGGTAAACAGG | No data | ||||
| 1020462044_1020462052 | 10 | Left | 1020462044 | 7:8437079-8437101 | CCAGAGGGCGCTGCGCATCAGCG | 0: 1 1: 0 2: 1 3: 3 4: 66 |
||
| Right | 1020462052 | 7:8437112-8437134 | CAGGACACCTTGGGGTAAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1020462052 | Original CRISPR | CAGGACACCTTGGGGTAAAC AGG | Intronic | ||
| No off target data available for this crispr | |||||