ID: 1020462052

View in Genome Browser
Species Human (GRCh38)
Location 7:8437112-8437134
Sequence CAGGACACCTTGGGGTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020462040_1020462052 28 Left 1020462040 7:8437061-8437083 CCGTAGCAGCCGCGGACGCCAGA 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1020462052 7:8437112-8437134 CAGGACACCTTGGGGTAAACAGG No data
1020462043_1020462052 19 Left 1020462043 7:8437070-8437092 CCGCGGACGCCAGAGGGCGCTGC 0: 1
1: 0
2: 3
3: 10
4: 110
Right 1020462052 7:8437112-8437134 CAGGACACCTTGGGGTAAACAGG No data
1020462044_1020462052 10 Left 1020462044 7:8437079-8437101 CCAGAGGGCGCTGCGCATCAGCG 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1020462052 7:8437112-8437134 CAGGACACCTTGGGGTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020462052 Original CRISPR CAGGACACCTTGGGGTAAAC AGG Intronic
No off target data available for this crispr