ID: 1020464920

View in Genome Browser
Species Human (GRCh38)
Location 7:8466616-8466638
Sequence TAGTATATCATTAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020464918_1020464920 27 Left 1020464918 7:8466566-8466588 CCTAGATAAAGACTCGAAGGGAC 0: 1
1: 0
2: 1
3: 15
4: 237
Right 1020464920 7:8466616-8466638 TAGTATATCATTAAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020464920 Original CRISPR TAGTATATCATTAAGGAAGA TGG Intronic
No off target data available for this crispr