ID: 1020465610

View in Genome Browser
Species Human (GRCh38)
Location 7:8475258-8475280
Sequence TCTGGGGACACCAAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020465610_1020465617 8 Left 1020465610 7:8475258-8475280 CCCTGCTGCTTGGTGTCCCCAGA 0: 1
1: 0
2: 2
3: 27
4: 276
Right 1020465617 7:8475289-8475311 CAGGGACTTTGTTTCCTTTGAGG 0: 1
1: 0
2: 3
3: 31
4: 290
1020465610_1020465613 -10 Left 1020465610 7:8475258-8475280 CCCTGCTGCTTGGTGTCCCCAGA 0: 1
1: 0
2: 2
3: 27
4: 276
Right 1020465613 7:8475271-8475293 TGTCCCCAGAGAGAATCTCAGGG No data
1020465610_1020465619 23 Left 1020465610 7:8475258-8475280 CCCTGCTGCTTGGTGTCCCCAGA 0: 1
1: 0
2: 2
3: 27
4: 276
Right 1020465619 7:8475304-8475326 CTTTGAGGTTTACCTTTAATAGG 0: 1
1: 0
2: 0
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020465610 Original CRISPR TCTGGGGACACCAAGCAGCA GGG (reversed) Intronic
900142865 1:1145810-1145832 TCAGAGGCCACAAAGCAGCATGG + Intergenic
900196127 1:1376440-1376462 ACTTGGGACTCCAAGCAGGAAGG + Intergenic
900209088 1:1444721-1444743 TCTGGGGACAGGGAGCTGCATGG - Intergenic
900218925 1:1496639-1496661 TCTGGGGACAGGGAGCTGCATGG - Intronic
900402835 1:2479642-2479664 ACTGCGGAGACCAAGCAGCCGGG - Intronic
901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG + Intronic
903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG + Intergenic
904434053 1:30482872-30482894 TCAGAGGACACCAAGAAGCTTGG + Intergenic
905626846 1:39495075-39495097 TCTGGGGCCACCAACCTTCAGGG - Intronic
908350292 1:63280275-63280297 TCTGGGGAAAGCAAGCTGCCAGG - Intergenic
911090674 1:94014636-94014658 GCTGGGGACATCAAACAGGAAGG + Exonic
912467235 1:109882560-109882582 GGTGGGGATACCCAGCAGCATGG - Intergenic
913157726 1:116116267-116116289 TCTGGGGCTACCAAATAGCACGG + Intronic
915270706 1:154751331-154751353 TCTCGGGACAACTAGCAGCTGGG + Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916052326 1:161045207-161045229 TCTGAGGACACCCAGCAACGGGG + Intronic
917401297 1:174652736-174652758 ACTGGGGACACCTCCCAGCAGGG - Intronic
918105491 1:181412586-181412608 CCTGGGGGCACCAAGCCACAAGG - Intergenic
919393280 1:197014172-197014194 TTTGGGGACCCCAAGAGGCATGG + Intergenic
920179287 1:204122572-204122594 TCTGGGCATTCCAAGCATCAGGG + Intronic
920868751 1:209775516-209775538 GCTGGGGACTCCAGGCAGCTTGG + Intronic
921196142 1:212759908-212759930 CCTGGGGCCACCCAGCAGCAAGG + Intronic
921939805 1:220827899-220827921 TCTGGGGACAACAGCCTGCAGGG + Intergenic
922272292 1:224044791-224044813 TGTGGGGACAGAAAGGAGCAAGG + Intergenic
923345288 1:233045704-233045726 GCTGGAGACACAAAGAAGCAGGG + Intronic
1063010950 10:2020929-2020951 TCTGGGGACACCAGGCAGAATGG - Intergenic
1063565623 10:7170649-7170671 TCTAGTGACACCACCCAGCAGGG - Intronic
1067084662 10:43231435-43231457 TCTGGGGTCAGGAGGCAGCAGGG - Intronic
1069855130 10:71436009-71436031 TCAGGGAAAACCCAGCAGCAGGG + Intronic
1071225406 10:83522977-83522999 TCAGGGGAGACAAATCAGCAGGG - Intergenic
1072217731 10:93302101-93302123 TCTTGCCACTCCAAGCAGCATGG - Intergenic
1072524934 10:96263335-96263357 TCTGGGGCCCCCAGCCAGCATGG + Intronic
1073255314 10:102147106-102147128 TCAGGGGACAGCAAGCTGGATGG - Exonic
1075604082 10:123791814-123791836 TCTGGGGACACTATTCAGCCTGG + Intronic
1075922143 10:126222533-126222555 TCTGGGGCCACCAGGAAGCCAGG - Intronic
1076350249 10:129810667-129810689 TCTGGGCCCACAGAGCAGCAGGG + Intergenic
1076591380 10:131586107-131586129 TCTGAGGTCACCCAGCAGCTTGG - Intergenic
1077051585 11:569043-569065 TTTGGGGACCCCAAGCCGCCCGG - Intergenic
1077053705 11:579636-579658 GCTGGGTCCACCAAGCACCAGGG + Intronic
1077902234 11:6498650-6498672 TCTGGGGACAGCAGTCAGCATGG - Exonic
1081927169 11:46840643-46840665 TCTGGGCACACCACGCTCCAGGG - Intronic
1082634134 11:55576396-55576418 TCTTGGGAGAGCAAGGAGCAAGG + Intergenic
1083198468 11:61104987-61105009 GCTGGGGACACCAAGGGCCAGGG + Intronic
1084268357 11:68016453-68016475 TCTGGGTACAGCAGGCATCATGG + Intronic
1084323416 11:68385880-68385902 GCTGGGGACGCTGAGCAGCATGG + Intronic
1085446712 11:76605585-76605607 ACTGGGCACACCCAGCACCAGGG + Intergenic
1085454333 11:76657176-76657198 GCTGGGGACCCCAAGGAGGAGGG + Intergenic
1086894794 11:92299510-92299532 TCTGTGCACAGCAAGGAGCATGG - Intergenic
1089158960 11:116423327-116423349 CCTGGGGAAAACAAGAAGCAGGG + Intergenic
1089500604 11:118929408-118929430 CCTGGGGACACAAAGCTGGAGGG + Intronic
1089789052 11:120929394-120929416 ACTGGGGTCACCGAGCTGCAGGG - Intronic
1090225526 11:125069973-125069995 TCTGGGGGCAGCTGGCAGCATGG + Intronic
1090351652 11:126111933-126111955 CATGGGGACACCAGGCAACAGGG - Intergenic
1090474094 11:127004007-127004029 CCTGGGGGCAACACGCAGCAAGG - Intergenic
1091665474 12:2415699-2415721 TCTGGTCACATCAAGCAGGAAGG - Intronic
1092622978 12:10293823-10293845 ACTGGGGAAACCCAACAGCAGGG + Intergenic
1092800219 12:12157390-12157412 TCTGGGGAGAACCAGTAGCAGGG - Intronic
1092996480 12:13955892-13955914 TCTGGTGCCACCATGCAGCTGGG - Intronic
1093420306 12:18967169-18967191 CCTGAGGTCTCCAAGCAGCAAGG - Intergenic
1096504956 12:52086948-52086970 TTTGGGGGCACCCAGCAGCCTGG - Intergenic
1096518416 12:52170843-52170865 TCTGGGGAGCCCAAAGAGCACGG + Exonic
1097838684 12:64300178-64300200 TCTAGAGAAAGCAAGCAGCAGGG + Intronic
1099480429 12:83158839-83158861 ACTGAGGACATAAAGCAGCAAGG - Intergenic
1099734986 12:86555606-86555628 TCCTGGGACAGCAAGGAGCAAGG - Intronic
1101382156 12:104223547-104223569 TGTTGGGAGACCAAGGAGCATGG + Intronic
1101419229 12:104535649-104535671 TATGGGTACACCGAGCAGAAGGG + Intronic
1101775666 12:107790825-107790847 TCTTGGGACCCCAAGAAGAAAGG - Intergenic
1102526474 12:113515658-113515680 TCTCGGGACACCGAGCATCCCGG + Intergenic
1102532835 12:113559295-113559317 GCTGGGGACATCGAGCAGGACGG - Intergenic
1103170580 12:118815511-118815533 TCTAGGAACACAAATCAGCATGG - Intergenic
1103925837 12:124422994-124423016 TCTGGGGAGGCCCAGCAGCCTGG - Intronic
1108257699 13:48626755-48626777 CCAGGGGACACTAAGGAGCAAGG + Intergenic
1110214284 13:73009247-73009269 TGTGGCCACACCTAGCAGCAAGG + Intronic
1111809522 13:93081583-93081605 TCTGGGGACATCAGGCAGATAGG - Intergenic
1112107155 13:96253244-96253266 CCTGGGGACATCTAGGAGCAAGG - Intronic
1112397055 13:99043068-99043090 TCTGGGGCCACCACTCAGAAGGG - Intronic
1112996282 13:105578280-105578302 TCTGGGGCTACCAAGGTGCATGG + Intergenic
1113090738 13:106615344-106615366 TTGGGGGACACCTAACAGCATGG + Intergenic
1113229266 13:108194843-108194865 ACTTTGGACACCAATCAGCATGG + Intergenic
1113823815 13:113234635-113234657 TTGGGGGACACCAAACAACACGG - Intronic
1115096810 14:29647645-29647667 CTTGGAGACACCAAGCAGCTGGG + Intronic
1115999561 14:39228558-39228580 TCCAGGGACACCGAGCAGAATGG - Intergenic
1117695812 14:58361592-58361614 TGTGGGGAAACTAAGCAGCAAGG + Intronic
1119228949 14:72965096-72965118 TCTGGGGACACCCAGGAGGCTGG - Intergenic
1119294397 14:73521275-73521297 TCTGCAGCCACCAAGCAGCAGGG + Intronic
1123023435 14:105412620-105412642 TTTGGGGACACTAAGTTGCAGGG + Exonic
1123953293 15:25306221-25306243 TCTGAGGACACCAATCAGATTGG + Intergenic
1124346187 15:28923008-28923030 GCTGGGGAAACCAGGCAGCTAGG + Intronic
1125540998 15:40470277-40470299 GCTGGGGGCACAAAACAGCAGGG - Intergenic
1127540527 15:59934167-59934189 CCTAGGGAGACCAAGGAGCAAGG + Intergenic
1129114298 15:73356684-73356706 TCTGGGGACACAGAGCTGGAGGG + Intronic
1130151217 15:81313179-81313201 TGTTGGGACACCAAGGAGCCTGG - Exonic
1130834513 15:87636070-87636092 TGTGAGGACACTAAGCAGCCTGG - Intergenic
1131524055 15:93138734-93138756 GCTGGGGACATCAAGCTGCCTGG + Intergenic
1131664434 15:94555424-94555446 TGTGCAGCCACCAAGCAGCAGGG + Intergenic
1132177450 15:99726641-99726663 TCTGGAGAGACAAAGCTGCAGGG - Intronic
1132526839 16:420917-420939 TCTGGGGACACCAGGGAGTGGGG - Intergenic
1132601371 16:774572-774594 TCTGTGGACACCCAGCAGGCCGG + Intronic
1132720430 16:1313001-1313023 ACTGGGGACACCAGGCAGACAGG - Intronic
1135099295 16:19592434-19592456 GCTGGGGGCACTAAGCAGCATGG + Intronic
1135738636 16:24954545-24954567 TCTGGGTACAACAAGGGGCATGG + Intronic
1136549131 16:30972994-30973016 TCTGGGCAAAGCAGGCAGCACGG + Intronic
1136650753 16:31668031-31668053 TCTTGGGAGATCAAGGAGCAAGG - Intergenic
1137028817 16:35503228-35503250 CCAGGGGTCACCATGCAGCAGGG - Intergenic
1137395488 16:48113936-48113958 CCTGGAGACACCCTGCAGCAGGG - Intronic
1137753518 16:50884141-50884163 TGTGGGGACACGAGGAAGCATGG + Intergenic
1138317358 16:56081572-56081594 TCTGGGGTGGCCAAGGAGCATGG + Intergenic
1139328559 16:66170187-66170209 TCTGGGGATATCAAGCAGTGGGG - Intergenic
1139337892 16:66245783-66245805 TCGGGGGACACCAGGCTTCAAGG - Intergenic
1140782112 16:78306416-78306438 TCTGTGGACACCATGATGCAGGG - Intronic
1141425105 16:83939843-83939865 TGTGGGGACAAAAAGCAGAAAGG + Intronic
1141640072 16:85335807-85335829 TCTGAGGCCTCCAAGCAGCCGGG + Intergenic
1141803521 16:86327093-86327115 CCTGGGGACAACATTCAGCATGG - Intergenic
1141855609 16:86679406-86679428 TCTGAGGACACCAGTCAGAATGG + Intergenic
1142382588 16:89741734-89741756 GCTGGGGACAAGAGGCAGCAAGG - Intronic
1143368327 17:6422735-6422757 TTTGGGGACAACGAGCAGCGAGG - Intronic
1143764684 17:9129813-9129835 TCTGGGACCACCAAACAGGAAGG - Intronic
1144069803 17:11659557-11659579 TCTTGGGAGAGCAAGGAGCAAGG - Intronic
1144496194 17:15747146-15747168 TCTTGGGAGAGCAAGAAGCAAGG + Intronic
1146563079 17:33888490-33888512 GCTGGGGACTCCCAGCAGCAAGG + Intronic
1148558959 17:48595092-48595114 CCTGGGGTCTCCAAGGAGCAAGG + Intronic
1150653914 17:67027275-67027297 TCTGGTGGCACCAAGCATCTGGG - Intronic
1150969740 17:70014073-70014095 TCTGTGGACAGCAACCAGCATGG - Intergenic
1152198004 17:78928770-78928792 CCTGAGGGCCCCAAGCAGCAGGG - Intergenic
1152310972 17:79549598-79549620 TCTGGGGACACCCAGGATGATGG + Intergenic
1152339873 17:79718266-79718288 TCTGGGGTCTCCACACAGCAAGG - Intergenic
1152772095 17:82176352-82176374 TCTTGGGAGAGCAAGGAGCAAGG - Intronic
1152782893 17:82234232-82234254 CCTGGGGTCACTGAGCAGCAGGG - Exonic
1153804036 18:8696370-8696392 TCTCGGGAAACCAACCATCAGGG - Intergenic
1154129779 18:11727006-11727028 ACTGAGGACCCCAAGCAGCCTGG - Intronic
1155127945 18:22898865-22898887 TCTGGGGAAACAAAGTTGCATGG - Intronic
1156012363 18:32510021-32510043 TCTGGGGCCACAGAGCAGCATGG - Intergenic
1156399217 18:36725548-36725570 TCTTGAGACTCCAGGCAGCAGGG + Intronic
1157472770 18:48002846-48002868 TTTGGGGATTCCAAGCAGGAGGG + Intergenic
1157888740 18:51394312-51394334 CCTGAGGACACCATGCTGCAAGG - Intergenic
1157995197 18:52546496-52546518 ACTGGGGACACCTATCAGAAGGG + Intronic
1160847717 19:1173806-1173828 TCGGGGGTCACCAAGCTGCGCGG + Intronic
1161260550 19:3335528-3335550 CCTGGGGACAGCAGGCAGCCAGG + Intergenic
1163520253 19:17787858-17787880 CCTGAGGTCACCCAGCAGCAGGG - Intronic
1166366125 19:42279382-42279404 TCTGGGGAAGCCAAGGGGCAGGG + Intronic
1166688420 19:44809307-44809329 TGTGGGGACCCCAAGGAGGAGGG + Intronic
1166737884 19:45096985-45097007 CCTGGGAACAGCAAGGAGCAGGG + Intronic
1167479865 19:49723350-49723372 TCTTGGGAGAGCAAGGAGCAAGG - Intergenic
925767015 2:7245949-7245971 TCTGGGGGCACTCAGCATCATGG + Intergenic
926291657 2:11536033-11536055 CCTGGGGATCCCAGGCAGCAGGG + Intronic
926401297 2:12499860-12499882 TCTGGGGGCACCAAGAAGGAAGG - Intergenic
928594485 2:32846886-32846908 TCTGGGGACATCTAGAACCAGGG + Intergenic
934598949 2:95642580-95642602 TGTGGGGGCCACAAGCAGCAAGG - Intergenic
934953084 2:98592635-98592657 CCTGTGAACACCAAGCAGCGCGG + Intronic
935216141 2:100976616-100976638 TATGGAGACAGCAAGCAGGAAGG - Intronic
935222738 2:101028866-101028888 TCGGGGGACACCAGGCATCATGG - Intronic
936134338 2:109876659-109876681 CAGAGGGACACCAAGCAGCAGGG - Intergenic
936210359 2:110494826-110494848 CAGAGGGACACCAAGCAGCAGGG + Intergenic
936263102 2:110979247-110979269 TGTGGGGTCACCAAGGAGCATGG - Intronic
936434945 2:112496219-112496241 CAGAGGGACACCAAGCAGCAGGG + Intronic
937858300 2:126688672-126688694 TCTGGGGCCACCAAGGAGCTTGG - Intronic
937858804 2:126692282-126692304 TCTGGGGCCACCAAGGAGCTTGG - Intronic
938558815 2:132451512-132451534 GTTTGGGACACCAAGCAGCAAGG + Intronic
938575516 2:132599545-132599567 TCTGGGGAAAACAAACACCATGG + Intronic
938928326 2:136064351-136064373 TCCAGGGGCACGAAGCAGCATGG + Intergenic
940513375 2:154647921-154647943 CCTGGTGACACCATGAAGCAGGG + Intergenic
940911725 2:159215434-159215456 TCTGGTCACACCAGTCAGCATGG - Intronic
940963862 2:159815991-159816013 ACAGAGGACACCAAGCAGTAGGG + Intronic
945995277 2:216431119-216431141 TGTGGGGACAACAGGCATCATGG - Intronic
946186344 2:217982848-217982870 TTTGCAGGCACCAAGCAGCAAGG - Intronic
947872059 2:233444732-233444754 TGTGGGGACAGCAAACACCAGGG - Intronic
948343883 2:237279197-237279219 TCAGGGGACACCAGGCAGGATGG + Intergenic
948567411 2:238895817-238895839 GCTGGGGGCTCCAAGCAGGAAGG + Intronic
1169790953 20:9410214-9410236 TGTGGGGACCCCATGCAGAATGG - Intronic
1170047576 20:12101573-12101595 ACTGGGAACACCAAGAGGCATGG - Intergenic
1171494804 20:25548377-25548399 TCAGAGGACACCAAGCAGCCTGG + Intronic
1172719349 20:36987493-36987515 TCTCAGGAAACCAACCAGCAGGG + Intergenic
1172843381 20:37915337-37915359 TCTGGGAACACTAAGCGCCAAGG + Intronic
1172952869 20:38733180-38733202 ACCAGGGACACCCAGCAGCATGG + Intergenic
1173521324 20:43702492-43702514 TCAGGTCACACCAAGCATCAGGG - Exonic
1173722158 20:45269013-45269035 TCTTGGGACACCAATCAGTGGGG + Intergenic
1173798382 20:45878588-45878610 TCTGGGGAAAGCAAGAAGAAGGG + Exonic
1174146417 20:48455538-48455560 TCTGGGGGCAGGAAGCAGCAGGG + Intergenic
1174447889 20:50602594-50602616 CCTTGGGCCACCCAGCAGCAAGG + Exonic
1177952692 21:27558801-27558823 GCTGGTGAGACCAAGCAGCCAGG + Intergenic
1179474104 21:41632331-41632353 TCTGGGGACACCCAGCGGACAGG + Intergenic
1180694804 22:17744801-17744823 TCTGGGCACACCCAGCTGCAGGG - Intronic
1181397006 22:22629835-22629857 GGTGGGGACCCCAGGCAGCAGGG + Intergenic
1181499751 22:23309194-23309216 GGTGGGGACCCCAGGCAGCAGGG + Intronic
1181557025 22:23677071-23677093 CCTGGGAGCACCCAGCAGCAGGG + Intergenic
1181697351 22:24600464-24600486 CCTGGGAGCACCCAGCAGCAGGG - Intronic
1181803234 22:25360554-25360576 GCTGGGGACGCTGAGCAGCACGG - Exonic
1182461584 22:30487271-30487293 TCTGGGGACACCGAGGACCCTGG - Intergenic
1183005131 22:34894933-34894955 TCTGGGGAGACCAGTAAGCAGGG - Intergenic
1183172932 22:36201432-36201454 TCTGGGGCCCCCATGCAACAAGG + Intronic
1183180342 22:36255547-36255569 TCTGGGGACTCCATGCAGCAAGG - Intronic
1183212290 22:36458357-36458379 ACTGGGGACCCCATGCAGCCTGG - Intergenic
1183457441 22:37930381-37930403 TCTGGGCACAGCAAGAAGCCAGG - Intronic
1184505767 22:44901116-44901138 TCTGGGGCCATCCAGCAGCTCGG + Intronic
1184550241 22:45200488-45200510 CCTGTGGTCACCAAGCAGGACGG + Intronic
1184653988 22:45932082-45932104 GCTGGGGAGATGAAGCAGCAGGG - Intronic
1185081019 22:48709399-48709421 CCTGGGAACCCCAACCAGCAGGG - Intronic
1185103009 22:48851702-48851724 TCTGTGGACACCAGGCCCCATGG + Intergenic
949597057 3:5558976-5558998 TTTGGAGACACCAAGCTGAATGG - Intergenic
949986409 3:9544743-9544765 TCTGGGGACTCTAAGCAACTAGG - Intronic
950613013 3:14138260-14138282 ACTGGGGACAGCAGCCAGCAGGG + Intronic
955363564 3:58293145-58293167 GCAGGGGCCACCAAGGAGCACGG - Intronic
956791328 3:72682360-72682382 TCCGCAGACACCAAGAAGCATGG + Intergenic
957174678 3:76791311-76791333 GCTGGGGACAGCAAGAGGCAAGG - Intronic
957217880 3:77345235-77345257 TGTGGGGACACCCAGCAGGGAGG - Intronic
960853567 3:122080018-122080040 TGTGGGAATTCCAAGCAGCAGGG + Intronic
960908192 3:122622421-122622443 TCTGGGGACACAACAAAGCAAGG - Intronic
961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG + Intronic
961959203 3:130836529-130836551 TCTAGGGACAGGAAGCAGCAGGG - Intergenic
962312990 3:134339053-134339075 GCTTGGTACACCAAGCAGAAGGG - Intergenic
962934604 3:140068182-140068204 TCTGGGGACACATTGCAGCCAGG + Intronic
963044159 3:141090264-141090286 ACTGAGGACACAAAACAGCAGGG + Intronic
965851472 3:173031034-173031056 TATGGGGACAGGAAGCAGAATGG + Intronic
967101438 3:186219327-186219349 GCTGGGGACAGCATGCAGCGTGG - Intronic
968446759 4:656014-656036 TGTGGGGACTCCAGACAGCACGG - Intronic
969191693 4:5526523-5526545 TCAGGGGAAACTTAGCAGCAGGG - Intronic
969804104 4:9593031-9593053 GCTGGGGCCACCAGGTAGCAAGG - Intergenic
971213907 4:24646106-24646128 TCTGGGGCCAGCAGGCTGCATGG - Intergenic
971265150 4:25090398-25090420 TCTGGGCACACCAGGCAGGGAGG + Intergenic
971383814 4:26125173-26125195 TCTGGCCACACCTAGCTGCAAGG + Intergenic
972986964 4:44776775-44776797 TCTTGGGACCTCAAGCAGAAAGG + Intergenic
973018877 4:45173959-45173981 TCTGGGGAAACCATCTAGCATGG + Intergenic
973079201 4:45968674-45968696 TCTGCAGACAACAAGAAGCATGG - Intergenic
973776919 4:54251724-54251746 TCTTGGGACATCAAGAAGAAAGG + Intronic
973812032 4:54580866-54580888 TTTGGGGTAACTAAGCAGCACGG + Intergenic
973884511 4:55306911-55306933 TATGGCCACACCAAGCTGCATGG - Intergenic
974587302 4:63896138-63896160 TGTGGGGACTCCAACCAGTAGGG + Intergenic
977171636 4:93769295-93769317 TCAGTGGACACAAAGCAGAAAGG + Exonic
978401176 4:108332748-108332770 TCTGGGGAGACCAGGAAACAAGG - Intergenic
978639354 4:110851223-110851245 GCTGGGGACTCTAAGCTGCAGGG + Intergenic
985679646 5:1249246-1249268 TCTGAGGTCACCAAGAACCAGGG + Intergenic
985789213 5:1916268-1916290 TGTGGGGCCACCAGGCAGCATGG + Intergenic
987862564 5:23506597-23506619 CCTGGGGACACCAAGAAGTATGG - Intergenic
989400076 5:40999388-40999410 TCTGGGGAAAAGAAGGAGCAAGG + Intronic
989537570 5:42582070-42582092 ACTTTGGACACCAACCAGCATGG + Intronic
990997869 5:61751320-61751342 GTTGGGGACTCCAAGCAGCAAGG - Intronic
991081902 5:62609764-62609786 CCTGGGGACACCAACTAACATGG - Intronic
992184642 5:74232298-74232320 TCTGGGGGCACAAAGGAGAATGG - Intergenic
992676677 5:79112251-79112273 TCTGGGGACACCCAGCCGTCAGG - Intronic
997030323 5:130120195-130120217 GTGGGGGACCCCAAGCAGCAAGG - Intronic
997582194 5:135025115-135025137 TCTGGGGGCGCCCAGCACCATGG - Intergenic
997814321 5:137001278-137001300 TTTGTGGACACAGAGCAGCATGG + Intronic
997826455 5:137111118-137111140 TCTGAGGACAGCAAGCAGTGAGG + Intronic
998199878 5:140111339-140111361 CCTGGGGGCAGCAATCAGCACGG + Intronic
1000528899 5:162393606-162393628 TCTGGGGACAGCTAAAAGCAGGG + Intergenic
1000939620 5:167344815-167344837 TGTGGGGACTCCAGGAAGCAAGG - Intronic
1001572142 5:172736862-172736884 TGTGGGGACACCGAGCCACAGGG + Intergenic
1001631990 5:173182309-173182331 TCTAGGGTCACCAAGCTGCCAGG + Intergenic
1002191429 5:177479846-177479868 TCTGGGAACGCCGAGCAGCACGG - Intergenic
1003615677 6:7653264-7653286 TGTGGTGACAGCAAGCACCAAGG - Intergenic
1003904317 6:10684878-10684900 ACAGGGGACACCCAGCAGGATGG + Intronic
1005593456 6:27352601-27352623 TCTTGGGAGAGCAAGGAGCAAGG - Intergenic
1005690508 6:28300410-28300432 ACTTGGGGCACCAAGGAGCATGG + Intronic
1006893624 6:37451518-37451540 GCTGGGAACACCAAACAGGAAGG - Intronic
1007077673 6:39078328-39078350 CCAGGGGACAACAAACAGCAGGG - Exonic
1007348607 6:41251830-41251852 GCTGGGCACACTCAGCAGCAGGG - Intergenic
1008011634 6:46474095-46474117 TCTGGGGACTCAAAGGAGAAAGG + Intronic
1011488696 6:87869205-87869227 TCTGAGGACACCAAGACACAAGG + Intergenic
1011726727 6:90217028-90217050 TTTGGGGACCCCAAGTTGCATGG - Intronic
1011761463 6:90570537-90570559 ACTGGGGACACCAAACATGAAGG + Intronic
1013368324 6:109450759-109450781 GCCTGGGACACCCAGCAGCAGGG - Intronic
1014508816 6:122294734-122294756 TCTGGGGACATCAATCTGTAAGG - Intergenic
1016788849 6:148044594-148044616 TCCTGGGACTCCAAGAAGCATGG + Intergenic
1017283698 6:152650729-152650751 TCTGGGGAGAGCAAAGAGCAAGG + Intergenic
1017576696 6:155813317-155813339 TCTTGGGACACCAGGCATGAAGG - Intergenic
1018949296 6:168368785-168368807 TTTGGGGAAACCAAGCAGAAAGG + Intergenic
1019621763 7:1995971-1995993 TCTGGTCACATCCAGCAGCATGG - Intronic
1019907410 7:4075173-4075195 TCTGGAGGCACCCAGCAGCCAGG + Intronic
1020465610 7:8475258-8475280 TCTGGGGACACCAAGCAGCAGGG - Intronic
1020746364 7:12083410-12083432 TATGGGGACATCAAGGAGAAGGG + Intergenic
1020929188 7:14371946-14371968 TCTTTGGAGACCCAGCAGCATGG - Intronic
1022661772 7:32374488-32374510 TCTGAGGGTGCCAAGCAGCATGG + Intergenic
1025753113 7:64310855-64310877 CCCGGGGTCACCATGCAGCAGGG + Intronic
1029068624 7:97876918-97876940 GCTGGGGCCACCAGGTAGCAAGG + Intergenic
1032387796 7:131536630-131536652 GCTGGGGACAGGAACCAGCAGGG - Intronic
1034558592 7:151865319-151865341 TCTGGGGTCAGCCAGCAGCTGGG - Intronic
1035113761 7:156505940-156505962 TCTGGGGGCACGAAGAATCAGGG + Intergenic
1036250940 8:7162111-7162133 GCTGGGGCCACCAGGTAGCAAGG + Intergenic
1036366550 8:8125344-8125366 GCTGGGGCCACCAGGTAGCAAGG - Intergenic
1037639929 8:20733237-20733259 TCAGGGATCATCAAGCAGCATGG + Intergenic
1040110456 8:43564893-43564915 GCTGGGGAGAAAAAGCAGCAAGG - Intergenic
1040591051 8:48792418-48792440 TCAGAGGACCCCAAGCAGCAGGG + Intergenic
1042801277 8:72720643-72720665 CCTGGGGACACCAAGATGAATGG - Intronic
1042877079 8:73449388-73449410 TCTGAGGACACCAGGCAGATTGG + Intronic
1043549108 8:81348917-81348939 TATGATTACACCAAGCAGCAAGG + Intergenic
1043885716 8:85597411-85597433 TCTGGGTGCAGAAAGCAGCAGGG - Intergenic
1044994008 8:97821681-97821703 TCTTGGGAGAGCAAGGAGCAAGG + Intronic
1046548078 8:115676517-115676539 GCTGGGGAAACCCAGCAGCTGGG - Intronic
1047178899 8:122568439-122568461 TCTTGGTACCCCCAGCAGCATGG + Intergenic
1048048098 8:130792100-130792122 GCTGAGGACAGCCAGCAGCATGG - Intronic
1053273514 9:36766276-36766298 TCTCAGGCCACCAAGCAGCCCGG - Intergenic
1054961126 9:70970815-70970837 TTTGGGGAGACCACTCAGCAAGG - Intronic
1056832901 9:89931101-89931123 TCTGCGCACACCATGGAGCATGG + Intergenic
1057401621 9:94728325-94728347 CCTGAGGACTCCAAACAGCAGGG - Intronic
1059404483 9:114091675-114091697 TCAGGAGAAACCAGGCAGCAGGG - Exonic
1061212332 9:129201113-129201135 TCTGGGGACAGAAAGCCCCAGGG + Intergenic
1062328162 9:136022640-136022662 CCTGGGGACACTGACCAGCAGGG - Intronic
1188445658 X:30250649-30250671 TCTGGGGAATGCCAGCAGCAGGG - Exonic
1189293915 X:39905402-39905424 TCTGGGAACACAAAGCCGCAGGG + Intergenic
1191066579 X:56354618-56354640 TCTGGGCACGCCAATCAGGAAGG - Intergenic
1193647608 X:84088686-84088708 TCTGGGGAGGCCAAGCAGTCAGG - Intronic
1196053070 X:111326033-111326055 TCAAGGGACACAAAACAGCAGGG - Intronic
1200000293 X:153056598-153056620 TCTGGGGACCCCGACCAGAAGGG + Intronic
1202248645 Y:22845336-22845358 TATTGGGTCACTAAGCAGCATGG + Intergenic
1202401633 Y:24479084-24479106 TATTGGGTCACTAAGCAGCATGG + Intergenic
1202469148 Y:25190999-25191021 TATTGGGTCACTAAGCAGCATGG - Intergenic