ID: 1020466540

View in Genome Browser
Species Human (GRCh38)
Location 7:8486038-8486060
Sequence TGGGATTTTAAAACATATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020466533_1020466540 27 Left 1020466533 7:8485988-8486010 CCCTTTCCAGCCTGACTTATGAA 0: 1
1: 0
2: 1
3: 21
4: 305
Right 1020466540 7:8486038-8486060 TGGGATTTTAAAACATATGATGG No data
1020466534_1020466540 26 Left 1020466534 7:8485989-8486011 CCTTTCCAGCCTGACTTATGAAG 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1020466540 7:8486038-8486060 TGGGATTTTAAAACATATGATGG No data
1020466539_1020466540 -5 Left 1020466539 7:8486020-8486042 CCTAGAAAGAGTTACTCTTGGGA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1020466540 7:8486038-8486060 TGGGATTTTAAAACATATGATGG No data
1020466535_1020466540 21 Left 1020466535 7:8485994-8486016 CCAGCCTGACTTATGAAGATAAA 0: 1
1: 0
2: 0
3: 17
4: 179
Right 1020466540 7:8486038-8486060 TGGGATTTTAAAACATATGATGG No data
1020466536_1020466540 17 Left 1020466536 7:8485998-8486020 CCTGACTTATGAAGATAAAATGC 0: 1
1: 0
2: 1
3: 16
4: 194
Right 1020466540 7:8486038-8486060 TGGGATTTTAAAACATATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020466540 Original CRISPR TGGGATTTTAAAACATATGA TGG Intronic
No off target data available for this crispr