ID: 1020466951

View in Genome Browser
Species Human (GRCh38)
Location 7:8490948-8490970
Sequence CTGTGTCTATGAATGTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 352}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020466951 Original CRISPR CTGTGTCTATGAATGTAAAT AGG Intronic
900163098 1:1233712-1233734 TTGTGTCGATGAGTGTAAGTTGG + Exonic
900194300 1:1367350-1367372 CTGTGTGGATGAGTGTGAATTGG + Intergenic
902111761 1:14084966-14084988 ATGTGTGTATGTGTGTAAATTGG + Intergenic
905406755 1:37738553-37738575 CATTGTGTAGGAATGTAAATTGG + Intronic
905550791 1:38836927-38836949 GTGTATATATGAATGTGAATGGG + Intergenic
906392136 1:45427302-45427324 CTGTTGGTAGGAATGTAAATTGG + Intronic
906720782 1:48002765-48002787 CTGTCGGTAAGAATGTAAATTGG - Intergenic
907963278 1:59303698-59303720 CTGTTGGTAGGAATGTAAATTGG - Intronic
909866288 1:80676341-80676363 CTGTTTCTTTGAATGTATAATGG - Intergenic
909872895 1:80765866-80765888 TTGTGTCTATGTATTTTAATTGG + Intergenic
910754074 1:90667809-90667831 ATGTGTGTATGAATATATATAGG + Intergenic
911459710 1:98174013-98174035 CTGAGTCAATGAAAGGAAATGGG - Intergenic
913964703 1:143366220-143366242 CTGTTGGTAGGAATGTAAATTGG - Intergenic
914059075 1:144191824-144191846 CTGTTGGTAGGAATGTAAATTGG - Intergenic
914120074 1:144774547-144774569 CTGTTGGTAGGAATGTAAATTGG + Intergenic
914918930 1:151834557-151834579 GTGTGACTATAAATGTTAATTGG - Intergenic
916372174 1:164110589-164110611 CTGGGTTCCTGAATGTAAATGGG - Intergenic
916764499 1:167847218-167847240 CTGTGTCTACTAATGTAAGAAGG - Intronic
917283530 1:173401760-173401782 GTGTGTATATGTATGTATATGGG - Intergenic
917950634 1:180029664-180029686 CTGTCTCTATGAATTTCACTAGG + Intronic
918278956 1:182984160-182984182 CTGTGTCGGTGAATTTGAATTGG - Intergenic
919657364 1:200210646-200210668 CTGTTTATATGAATGGAAATTGG + Intergenic
921933623 1:220776125-220776147 CTGTTGGTAGGAATGTAAATTGG - Intronic
922251808 1:223856087-223856109 CTGTCTCAATTAATGTACATTGG - Intergenic
923483825 1:234410248-234410270 CAGTGTGTATGCATGTAAATGGG + Intronic
924222513 1:241892866-241892888 CTATGGCTATGAATTTGAATTGG + Intronic
924320668 1:242845578-242845600 CTCTTTCTAGAAATGTAAATTGG - Intergenic
924488120 1:244507354-244507376 CTGTTGGTAGGAATGTAAATCGG - Intronic
1064909052 10:20380113-20380135 CTGTGTTTATGAAGCTAAAGAGG - Intergenic
1066025170 10:31349518-31349540 CTGTTGCTGGGAATGTAAATTGG - Intronic
1067207401 10:44231372-44231394 GTGTGTCTTTGCATGTAAGTGGG + Intergenic
1067767863 10:49101993-49102015 GTGTGTGTATGAATGTCAATAGG + Intronic
1067984508 10:51127501-51127523 CTGTTGGTAGGAATGTAAATTGG + Intronic
1069092367 10:64216438-64216460 CTATGAGAATGAATGTAAATTGG + Intergenic
1070392487 10:75983585-75983607 ATGCGTCTATGTATGTGAATAGG + Intronic
1071071515 10:81699156-81699178 GTGTGTCTTTGCATGTAAGTTGG - Intergenic
1071127795 10:82355017-82355039 CTGTTTCTAGGAATGTAATTTGG - Intronic
1071445613 10:85743532-85743554 CTGTGTCTAGGAAGGAAGATAGG + Intronic
1071808806 10:89155404-89155426 TTGTGTCTAAGAATGTAAGAAGG + Intergenic
1073600877 10:104844964-104844986 CTGTTTCTCTGCATATAAATTGG + Intronic
1076323343 10:129600447-129600469 CTGGGTCTATTAATGAGAATGGG - Intronic
1077706835 11:4494838-4494860 CTGTGTACATCAATTTAAATGGG + Intergenic
1078574532 11:12487881-12487903 CTGTCTCTATGAATGGGACTAGG + Intronic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1078661247 11:13288135-13288157 CTGTGTCCATGAATGCAAACTGG - Intronic
1079920339 11:26426101-26426123 CTGTGTGTGTGTCTGTAAATGGG + Intronic
1080258172 11:30316416-30316438 GTATGTTTATGAGTGTAAATTGG + Intergenic
1081204980 11:40264580-40264602 CTGTGCCGATGAATATAACTAGG + Intronic
1081214860 11:40383457-40383479 CTGTTGGTAGGAATGTAAATTGG - Intronic
1082225052 11:49695526-49695548 CTGTTTCTGAGAATGTAAATTGG - Intergenic
1083992604 11:66256218-66256240 CTGTCTCTAAGAAAATAAATTGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085842840 11:80032822-80032844 CTGTTGGTAGGAATGTAAATTGG + Intergenic
1086624056 11:88924199-88924221 CTGTTTCTGAGAATGTAAATTGG + Intronic
1089065945 11:115662114-115662136 CTGGGTATAGGAATGAAAATGGG + Intergenic
1089877181 11:121735486-121735508 CTGTGGGTGGGAATGTAAATTGG - Intergenic
1090028956 11:123191624-123191646 CCTTGTCTATTAATGCAAATAGG - Intronic
1090708769 11:129365991-129366013 CTGTTTGTGGGAATGTAAATTGG - Intergenic
1092062717 12:5564330-5564352 CTGTCTCAATGAATGAATATAGG + Intronic
1092697935 12:11194435-11194457 CTGTGTGTATGAATGTAATATGG + Intergenic
1093659576 12:21738345-21738367 CTGTTTCTATGAATTTGACTAGG + Intronic
1094669599 12:32556454-32556476 CTGTTTCTATGATTTTAAAGTGG + Intronic
1095213663 12:39523779-39523801 GGGTGTCAATGAATGTGAATTGG + Intergenic
1095866001 12:46972736-46972758 CTGTGTCTATGAGTGGAAGCAGG - Intergenic
1096187691 12:49593082-49593104 CTGTGTCTCTATATTTAAATTGG - Intronic
1098481996 12:70973495-70973517 CATTGTGTATGAATGTATATGGG - Intergenic
1099068947 12:78021168-78021190 ATTTGTCTATGTATGTACATGGG - Intronic
1099343167 12:81464674-81464696 TCCTGTCTAGGAATGTAAATAGG - Intronic
1100767920 12:97888005-97888027 CAGTGACTATGAATGTGAGTTGG + Intergenic
1101067359 12:101036240-101036262 CTGTTAGTAGGAATGTAAATTGG + Intronic
1101234407 12:102774520-102774542 ATGTGTCCATAAATGTACATTGG - Intergenic
1102539982 12:113611521-113611543 CTTTGTTTAGGAATATAAATGGG - Intergenic
1104035577 12:125095019-125095041 GTGTGTCTGTGTGTGTAAATAGG + Intronic
1104287354 12:127436244-127436266 ATGTCTCTATAGATGTAAATAGG - Intergenic
1106134062 13:26961316-26961338 CCGTGTCTATGCATGTAAAGTGG - Intergenic
1107282352 13:38751244-38751266 CTGTTGATGTGAATGTAAATTGG - Intronic
1107979593 13:45721886-45721908 CTGTGTTTAAGCATGTAAAGAGG - Intergenic
1108132580 13:47318817-47318839 CTGTTTATATGAATGTAGACTGG + Intergenic
1109117181 13:58403051-58403073 CTGTTGGTAGGAATGTAAATTGG - Intergenic
1110525822 13:76535693-76535715 CTGTTTGTGTGAATGTAAATTGG + Intergenic
1110880107 13:80561174-80561196 CTGAGTTTATGAATATAAAATGG + Intergenic
1110934842 13:81275195-81275217 CTGTTGGTAGGAATGTAAATTGG + Intergenic
1111546687 13:89747292-89747314 GTGTGTATATGTGTGTAAATTGG + Intergenic
1111657731 13:91174454-91174476 CTCTGTCTATAAAGATAAATTGG + Intergenic
1111721729 13:91955202-91955224 GTGTGTTTATGTATTTAAATTGG + Intronic
1112103697 13:96217758-96217780 GTGTGACTATGTATGTATATAGG + Intronic
1112880033 13:104095747-104095769 CCATGTCAATGTATGTAAATAGG - Intergenic
1113342207 13:109437522-109437544 ATGTGTGTATGTATGTATATAGG - Intergenic
1113351901 13:109537716-109537738 CTGTTCCTATGTATGTAACTTGG + Intergenic
1114858216 14:26479704-26479726 TTGTGTCTATAAATTTAAAAAGG + Intronic
1115082195 14:29468386-29468408 CTATCTCTATGAATTTAACTAGG + Intergenic
1115763792 14:36602132-36602154 CTGTATTTATGACTGTGAATGGG - Intergenic
1115929955 14:38479727-38479749 CTGTTCCTGAGAATGTAAATTGG - Intergenic
1116185708 14:41598545-41598567 CTATGTGTGTGTATGTAAATAGG + Intergenic
1116301615 14:43190297-43190319 GTGTGTCTTTGAATGTGAAATGG - Intergenic
1116454492 14:45103365-45103387 CTGTGTCTTTGCTTTTAAATTGG + Intronic
1117760264 14:59019558-59019580 CTGTTGGTAGGAATGTAAATTGG + Intergenic
1118145718 14:63133583-63133605 CTGTTTTTGGGAATGTAAATTGG + Intergenic
1120120257 14:80670411-80670433 CTGTGTGTATGTATATAAATAGG - Intronic
1120773124 14:88403212-88403234 CTGTTGCTAGGAATGTAAGTTGG + Intronic
1121569799 14:94939189-94939211 CTGTGTCCATGAATATCTATGGG - Intergenic
1121809917 14:96875929-96875951 GTGTGTGTATAAATGTATATAGG - Intronic
1202893344 14_KI270722v1_random:180564-180586 ATGTGGCTAAGCATGTAAATAGG - Intergenic
1123689895 15:22829613-22829635 ATGTGTCTATGTATGCTAATTGG - Exonic
1124816141 15:32994805-32994827 CTATGTTTATGGCTGTAAATAGG - Intronic
1124996092 15:34724111-34724133 CTGTGTCTTGGAATGAGAATGGG - Intergenic
1127665738 15:61145346-61145368 CTGTGTCCATATCTGTAAATTGG - Intronic
1129301707 15:74629240-74629262 GGGTGGCTATGAATGTAATTGGG + Intronic
1130387725 15:83426579-83426601 CTGTTTCTTTGTCTGTAAATTGG - Intergenic
1131082121 15:89545681-89545703 ATGTGTGTATGAATGTAATCAGG + Intergenic
1132967012 16:2662390-2662412 CTGTGTCCATCCATTTAAATGGG + Intergenic
1133812492 16:9171491-9171513 CTATGTCTATACATATAAATAGG + Intergenic
1135839798 16:25865249-25865271 TTGTTGCTGTGAATGTAAATTGG - Intronic
1137839954 16:51631380-51631402 CAGTGTCCATGAATAAAAATTGG + Intergenic
1138140200 16:54561751-54561773 GTGTGTCTCTGAATGTAGATGGG - Intergenic
1139184403 16:64788517-64788539 CTGTTAGTAAGAATGTAAATTGG - Intergenic
1139314117 16:66053602-66053624 ATGTGTCTATGTATGTAGCTAGG - Intergenic
1140955012 16:79855460-79855482 GTGTGTCTTTGCATGTAAAATGG + Intergenic
1144132119 17:12256168-12256190 CTGTGTGTAAGAATGTAAGAAGG - Intergenic
1145388161 17:22433774-22433796 CTGAGGCTCAGAATGTAAATAGG - Intergenic
1148637799 17:49162441-49162463 CTGTGGTTAGGAATGTAAATTGG + Intronic
1149471099 17:56915765-56915787 GTGTGTCTAAGAATGGACATTGG + Intergenic
1149914344 17:60594938-60594960 CATTGTGTGTGAATGTAAATTGG - Intergenic
1150551099 17:66211035-66211057 TTGTGTTTATGAATTTAAAATGG + Intergenic
1151737443 17:75953044-75953066 CTGTGGCTATGAATGCAAAAGGG + Intronic
1153663731 18:7349689-7349711 CTGTGTCTATATTTGGAAATAGG - Intergenic
1155430748 18:25754407-25754429 CTGTCGGTAGGAATGTAAATTGG + Intergenic
1155879035 18:31121188-31121210 CTCTCTCTAAGAATGTAAATTGG - Intergenic
1157067078 18:44364942-44364964 TTGTGTCTGTGTATGTTAATTGG + Intergenic
1159027536 18:63199120-63199142 CTGTGTCTGTGCCTGTACATGGG - Intronic
1159283282 18:66314923-66314945 CTGTGTTTATGAGTATAAAAGGG - Intergenic
1162015266 19:7842163-7842185 CTGTGTGTGTGAATGTGCATGGG + Intronic
1162584096 19:11548535-11548557 CTGTCTCTAAAAATGAAAATGGG + Intronic
1164083687 19:21882375-21882397 CTGTGTCCATCCATTTAAATGGG + Intergenic
1164195310 19:22951772-22951794 CTGTGTCTTTGCATGTAAGATGG - Intergenic
1164616701 19:29671274-29671296 CTATATCTATGAATAAAAATAGG - Intronic
1164996856 19:32727034-32727056 CTGTTGGTATGAATGTAAAACGG - Intronic
1165283229 19:34815631-34815653 CAGAGTCCATGAATGGAAATGGG - Intergenic
1166026283 19:40088540-40088562 CTGTGGGTGAGAATGTAAATGGG + Intronic
1168205647 19:54848716-54848738 CTGTATCTTTGGATGGAAATTGG - Intronic
1202698479 1_KI270712v1_random:143710-143732 CTGTTGGTAGGAATGTAAATTGG - Intergenic
924997864 2:380373-380395 CTGTTGGTGTGAATGTAAATTGG + Intergenic
925315067 2:2915793-2915815 CTGTTGCTGGGAATGTAAATTGG - Intergenic
925322316 2:2983047-2983069 CTGTTGGTAGGAATGTAAATTGG + Intergenic
926732187 2:16044140-16044162 GTGTGTGTCTGAATGTTAATAGG - Intergenic
926939666 2:18121631-18121653 CTGTTGGTAGGAATGTAAATTGG + Intronic
927347974 2:22069752-22069774 CTGTGTCTAGGAATGTCATCTGG - Intergenic
927364815 2:22282318-22282340 GTGTGTGTATGAATATATATTGG + Intergenic
927416184 2:22883082-22883104 GTGTGTCTGTGTGTGTAAATGGG - Intergenic
927590915 2:24357019-24357041 CTGTTGCTGGGAATGTAAATTGG + Intronic
929339455 2:40796523-40796545 CTGCTAGTATGAATGTAAATTGG - Intergenic
929359644 2:41070971-41070993 ATATGTATATGTATGTAAATTGG + Intergenic
930211603 2:48644633-48644655 CTGTTTGTATGAATGTATATTGG - Intronic
930308416 2:49706371-49706393 CTGTTTCTAGGAATATAATTGGG - Intergenic
930427063 2:51225751-51225773 CACTGTCTCTGAATGGAAATAGG + Intergenic
930542816 2:52728670-52728692 CTGTTGGTAGGAATGTAAATTGG - Intergenic
931351395 2:61491959-61491981 CTGTATGTATCAATGGAAATAGG - Intronic
931952200 2:67377142-67377164 CTGTTGGTAGGAATGTAAATTGG - Intergenic
932015452 2:68022311-68022333 CTGTTTGTGGGAATGTAAATTGG - Intergenic
932019272 2:68065996-68066018 GTGTGTCTCTGAATGTGAGTTGG - Intronic
933017444 2:77146622-77146644 CTGTGACTTTTAATGGAAATAGG - Intronic
933414494 2:81969106-81969128 CTGTTGGTAGGAATGTAAATTGG + Intergenic
933747569 2:85582203-85582225 CTGTGACAATGAATGGAACTGGG - Intergenic
934279726 2:91601492-91601514 CTGTTGGTAGGAATGTAAATTGG - Intergenic
934789498 2:97046694-97046716 CTGCAGCTATCAATGTAAATAGG - Intergenic
935533709 2:104267253-104267275 CTGTTAGTAGGAATGTAAATTGG + Intergenic
936880067 2:117239821-117239843 CTGTTTGTGGGAATGTAAATAGG + Intergenic
937103199 2:119287404-119287426 CGGTGTGTATGTATGTACATGGG - Intergenic
937496140 2:122421937-122421959 CTGTGTCTATGCCTGTGATTGGG - Intergenic
939565786 2:143785146-143785168 CTGTGTTCATGAATGTAAAATGG - Intergenic
939797347 2:146662617-146662639 CAGTTTCTATGAAAGAAAATAGG + Intergenic
940132455 2:150397922-150397944 CTGTTGATAGGAATGTAAATTGG - Intergenic
941017837 2:160377156-160377178 CTGTGCCTATTTATGTATATAGG - Intronic
941609525 2:167643966-167643988 CAGTGTCAATGTCTGTAAATTGG + Intergenic
943743050 2:191431823-191431845 CTGTGGCTTTGAATTTAAATGGG + Intergenic
943782464 2:191839525-191839547 CTGTGTATATGAATGGGTATTGG + Intronic
944219045 2:197284156-197284178 TTCTGTCTATTAATGTCAATAGG - Intronic
944541972 2:200762717-200762739 ATGTGTGTATGAATACAAATGGG - Intergenic
944757789 2:202781856-202781878 CTGCGTGTAGGAGTGTAAATTGG - Intronic
944787831 2:203091568-203091590 CTGTTGGTATGAATGTAAAATGG - Intronic
944791534 2:203134125-203134147 CTGTTTGTATAAATGTAAACTGG - Intronic
944982609 2:205138713-205138735 CTGTATATATGAATGGGAATGGG + Intronic
945517753 2:210783820-210783842 CTGAGTCTAAGAAAGAAAATTGG + Intergenic
946707913 2:222476740-222476762 GTGTGTATATGTATGTATATAGG + Intronic
947357245 2:229309397-229309419 CTTTCTCTATCAATGTAATTTGG - Intergenic
947939924 2:234044240-234044262 CTGTTTATGTGAATGTAAAATGG + Intergenic
949069667 2:242016693-242016715 CTTTGAATATGAATGTACATTGG + Intergenic
1170390100 20:15863222-15863244 TTCTGACTATGAATATAAATGGG - Intronic
1171516002 20:25736433-25736455 CTGTCACTGGGAATGTAAATTGG - Intergenic
1172802843 20:37590300-37590322 CTGTGTGTATGGCTGTGAATGGG + Intergenic
1173804341 20:45914055-45914077 CTGTCTCTAAAAATATAAATAGG - Intergenic
1174959335 20:55137443-55137465 CTCTGTCAATGAACGTAAACAGG + Intergenic
1175226665 20:57448473-57448495 GTGTGTCTGTGAATGTACACAGG - Intergenic
1176345702 21:5744444-5744466 CACTAACTATGAATGTAAATGGG - Intergenic
1176352516 21:5865028-5865050 CACTAACTATGAATGTAAATGGG - Intergenic
1176499125 21:7580011-7580033 CACTAACTATGAATGTAAATGGG + Intergenic
1176540023 21:8142514-8142536 CACTAACTATGAATGTAAATGGG - Intergenic
1176558974 21:8325559-8325581 CACTAACTATGAATGTAAATGGG - Intergenic
1177718860 21:24878447-24878469 CTGTTGGTAGGAATGTAAATTGG - Intergenic
1179074584 21:38107979-38108001 CTGCTGCTATGAATGTAAAATGG + Intronic
1179302638 21:40126122-40126144 CTGTTTCTATGACAGTTAATGGG + Intronic
1179475854 21:41643435-41643457 CTGTGGTTAGGAATGTAAAATGG + Intergenic
1179480763 21:41676852-41676874 CTGTGGTTAGGAATGTAAAATGG - Intergenic
1180033201 21:45226355-45226377 CACTTTCTATGAATGTAATTCGG + Exonic
1181658870 22:24325655-24325677 CTGTGGCCATGAATGAAAAAAGG + Intronic
1203244970 22_KI270733v1_random:58873-58895 CACTAACTATGAATGTAAATGGG - Intergenic
949420582 3:3861253-3861275 CTCTGTCTATATATGTCAATTGG - Intronic
951317787 3:21207412-21207434 CACTGTCTCTGAATGGAAATGGG + Intergenic
952234558 3:31465330-31465352 ATGTGTCTAGATATGTAAATAGG - Intergenic
952417243 3:33100597-33100619 CTCTGTCTGTGCATTTAAATGGG - Intergenic
952921535 3:38288140-38288162 CTGTGTCTATGAATTTGACTAGG + Intronic
953817581 3:46172892-46172914 CTGTTTGTGGGAATGTAAATTGG - Intronic
954089077 3:48270595-48270617 CTGTGTCAATGAGTGTACCTTGG + Exonic
954288089 3:49633470-49633492 CTGTTTTTAGGAATGTAAAATGG + Intronic
955767582 3:62361014-62361036 CTGGGTCTCTGAATGTTAAGCGG + Intergenic
959949988 3:112169468-112169490 ATGTGTCTATCAATGAAAATTGG + Intronic
960887116 3:122407164-122407186 TAGTGTCTATAAATATAAATAGG - Intronic
961155840 3:124678802-124678824 CTGTGTCCATGCAAGTAAAATGG - Intronic
961570900 3:127798114-127798136 CTGTGTCTTTGACTGTTAGTAGG - Intronic
961992854 3:131210861-131210883 GTGTGTCTCTGAATGTGAAATGG + Intronic
962240005 3:133744245-133744267 CTTAGTCTACGAATGTAGATGGG + Intergenic
963101362 3:141608622-141608644 CTGTGTATCTGAACGGAAATTGG + Exonic
963333363 3:143942027-143942049 CTGTTGATAGGAATGTAAATTGG + Intergenic
965206408 3:165723041-165723063 ATTTGGCTATGAATGTAAATAGG + Intergenic
965392766 3:168125449-168125471 CTGTTGATGTGAATGTAAATTGG - Intergenic
965409819 3:168316715-168316737 ATGTGTGTATGAATATAAATGGG - Intergenic
965978035 3:174649710-174649732 CTGTGTGTATGTATGTATAAAGG - Intronic
966064502 3:175801822-175801844 TTGTATCTATGAATGTATAAAGG + Intronic
967454414 3:189666847-189666869 TTGTGTGTATGTATGTAAATGGG + Intronic
967522572 3:190451488-190451510 CTATGTGTGTGATTGTAAATGGG - Intergenic
967769970 3:193324028-193324050 CTGAGACTATGAATCTAAAGGGG - Intronic
969852930 4:9976379-9976401 CTCAGTCTTTGAAGGTAAATGGG + Intronic
969926270 4:10588607-10588629 TTGTGAAAATGAATGTAAATGGG - Intronic
970037569 4:11755345-11755367 CTGTCTCTATTAATCTAAAATGG - Intergenic
970743897 4:19271659-19271681 TTGTGTGTAGGAATGTGAATAGG + Intergenic
970963315 4:21898508-21898530 CTGTGTCTAGAAATGTTATTGGG - Intronic
971116271 4:23649233-23649255 CTGTTGGTAGGAATGTAAATTGG - Intergenic
972753945 4:42024661-42024683 CTGTGATTGTAAATGTAAATTGG - Intronic
972787294 4:42338595-42338617 CTGTGGGTGGGAATGTAAATTGG + Intergenic
973031512 4:45347723-45347745 CAGTCACTATGAATGTACATGGG - Intergenic
973192459 4:47401289-47401311 CTGTTGGTAGGAATGTAAATTGG + Intronic
973931624 4:55798797-55798819 CTGTGGGTAGGAATGTAAAACGG + Intergenic
974354379 4:60793620-60793642 CTGTGTCTATGAAAATTAATTGG + Intergenic
975282371 4:72575859-72575881 CTGTGTTTATGAAATAAAATTGG - Intergenic
975400720 4:73935520-73935542 CTGTGTGTATATATGTATATAGG + Intergenic
975869497 4:78763968-78763990 CTGTGTATATGAGTGTATTTAGG - Intergenic
976316751 4:83666860-83666882 CTCTGTTTATGAATGGAAGTGGG + Intergenic
976455459 4:85241592-85241614 CTGTTGGTAGGAATGTAAATTGG + Intergenic
976830234 4:89307377-89307399 CTCTGGCTTTGAAGGTAAATGGG - Intronic
977246726 4:94640100-94640122 CTGTGACTATGTAGGTAAATGGG - Intronic
978326106 4:107558336-107558358 CTGTGTCAATAAATGTAAATAGG - Intergenic
978553721 4:109955809-109955831 CTGGGACTATAAATGTGAATAGG + Intronic
978587122 4:110285257-110285279 CTGTTGATAGGAATGTAAATTGG + Intergenic
979442842 4:120772382-120772404 TTATGTTTATGACTGTAAATAGG - Intronic
980587896 4:134841920-134841942 CTGTGTATGTGAAAGTAAAAGGG - Intergenic
981670645 4:147282854-147282876 CTGTTTCTGGGAATGTGAATTGG + Intergenic
982817972 4:159909500-159909522 CTGTGGGTGGGAATGTAAATTGG + Intergenic
983476841 4:168222425-168222447 CTGTTATTATGAGTGTAAATTGG + Intronic
983609074 4:169622672-169622694 CAGTTTCTACGAATGTAAAACGG - Intronic
986663603 5:10080816-10080838 CTCTGGTTATGAATGTGAATTGG - Intergenic
988251381 5:28762386-28762408 GTGTGTTTATGATTGTACATAGG - Intergenic
988307459 5:29511159-29511181 ATGTTTCTATTAATTTAAATTGG - Intergenic
989291697 5:39774673-39774695 TTGTGTTTAGGAATGTAAAATGG + Intergenic
989787967 5:45354005-45354027 ATGTGTGTATAAATATAAATAGG - Intronic
990080795 5:51911394-51911416 CAGTGTCTATGAAAGCTAATAGG + Intergenic
992590410 5:78290255-78290277 TTGTCTCTATAAATGAAAATGGG - Intronic
993474048 5:88343026-88343048 CTCTCTCTGTGAATGTGAATGGG + Intergenic
993878023 5:93330772-93330794 CTGTGTCTATGTTGGTAAACTGG - Intergenic
994172438 5:96672269-96672291 CTGTGTGTGTGTATGCAAATAGG + Intronic
994268151 5:97742428-97742450 CTGTGTCTATGAAATTACTTTGG + Intergenic
996204332 5:120712865-120712887 CTGTTGATAGGAATGTAAATTGG + Intergenic
996209205 5:120784307-120784329 CTGTTGGTAGGAATGTAAATTGG - Intergenic
996408785 5:123133130-123133152 CTGTGAATATGAAAGTAAAAAGG + Intronic
996430469 5:123370708-123370730 ATGTGTGTATGTATGTATATAGG - Intronic
996900166 5:128536124-128536146 CTATGTCTATTAATACAAATTGG - Intronic
997105411 5:131013282-131013304 CTGTTGGTAGGAATGTAAATTGG + Intergenic
999887816 5:155942745-155942767 CTGTGTCTAGGAATTTTGATAGG - Intronic
1000678294 5:164151264-164151286 CTGAGTCTTAGGATGTAAATTGG + Intergenic
1002757344 6:174402-174424 CTGTTGGTAGGAATGTAAATTGG + Intergenic
1004280120 6:14273407-14273429 CTGTGCCTCTGAATGGAAAATGG + Intergenic
1004450812 6:15744164-15744186 CTGTGAATGGGAATGTAAATTGG - Intergenic
1004698270 6:18054469-18054491 CTGTTGCTGTGAATGTAAACTGG + Intergenic
1005059857 6:21765648-21765670 ATGTGTTTATGAATGTAAGAAGG - Intergenic
1005725667 6:28645307-28645329 CTGTGTGTATACATGTATATAGG + Intergenic
1007023305 6:38544427-38544449 GTGTGTATATGTATGTATATGGG + Intronic
1007187858 6:39987743-39987765 CTGTATCTATGCATGTACATAGG - Intergenic
1007746276 6:44045162-44045184 GTGTGTATATGAATGTAGGTAGG - Intergenic
1009324425 6:62332364-62332386 CTGTGGGTAGGAATGTAAAATGG - Intergenic
1009568489 6:65347291-65347313 CTGTGTCTTCGTATGTAAACTGG + Intronic
1009979343 6:70708563-70708585 CTATTGGTATGAATGTAAATTGG - Intronic
1010047041 6:71457236-71457258 TTATGTCTATGAATGTACATTGG + Intergenic
1010469474 6:76209614-76209636 CTGTTTGTGGGAATGTAAATGGG + Intergenic
1011574141 6:88776135-88776157 CTGTTGGTAGGAATGTAAATTGG - Intronic
1011877877 6:91984353-91984375 CTTTGTCACTGAATGTAATTTGG + Intergenic
1011946825 6:92915103-92915125 CTGTTGGTAGGAATGTAAATTGG + Intergenic
1012032208 6:94086008-94086030 CTTTGCCTATGAAATTAAATTGG + Intergenic
1012525061 6:100167743-100167765 CTCTGTCTCTGAATGATAATAGG + Intergenic
1012665469 6:101962930-101962952 CTGTATCTTTGAATATAAACTGG + Intronic
1012770080 6:103421754-103421776 CTATATTTATGAATATAAATTGG + Intergenic
1012962159 6:105633616-105633638 CTGTTGATAAGAATGTAAATTGG + Intergenic
1013160214 6:107536343-107536365 CTGCATTTGTGAATGTAAATTGG + Intronic
1014465472 6:121751333-121751355 CTGTTGATAGGAATGTAAATTGG - Intergenic
1015220384 6:130797663-130797685 CTGTTGCTGGGAATGTAAATTGG - Intergenic
1016134206 6:140518939-140518961 CTGTTGATATGAATGTAAAATGG - Intergenic
1016605475 6:145918341-145918363 TTGTGTTTTAGAATGTAAATAGG - Intronic
1018572982 6:165230237-165230259 ATGTGTCTAAAAATGTGAATAGG + Intergenic
1019869832 7:3749917-3749939 CTGTGTGAATCAATATAAATTGG + Intronic
1020252049 7:6477099-6477121 GTGTCTCTGTGACTGTAAATAGG + Intronic
1020466951 7:8490948-8490970 CTGTGTCTATGAATGTAAATAGG + Intronic
1021014027 7:15509957-15509979 CTGTGAGTGAGAATGTAAATTGG + Intronic
1021035421 7:15792375-15792397 CTGTTGGTAGGAATGTAAATCGG + Intergenic
1021160365 7:17265022-17265044 CTGTTAATAGGAATGTAAATTGG - Intergenic
1021431690 7:20566816-20566838 CTGTGTACAGGAATGTAAAATGG + Intergenic
1022483889 7:30763026-30763048 CTGTCACTCTGAATGGAAATGGG + Intronic
1024368616 7:48553407-48553429 CTGTTAGTAGGAATGTAAATTGG - Intronic
1024652833 7:51421256-51421278 CTATTTCTAAGAATGTAAGTTGG + Intergenic
1024752623 7:52486254-52486276 CTGTGTATATGTATGTACATAGG - Intergenic
1026028150 7:66764071-66764093 CTGTTTGTAGGAATGTAAAATGG - Intronic
1026393220 7:69924362-69924384 CTGTGTTCATGAATAAAAATTGG + Intronic
1026484303 7:70804756-70804778 CTGTTGGTAGGAATGTAAATTGG + Intergenic
1027378437 7:77577760-77577782 CTGTGTTTTAGAATTTAAATGGG + Intronic
1028972835 7:96877665-96877687 CTGTTGGTGTGAATGTAAATTGG - Intergenic
1029797356 7:102909664-102909686 GTGTGTCTAGAAATGTAACTTGG + Intronic
1029874303 7:103732765-103732787 CTGTGTCTAACAATTTAACTTGG + Intronic
1030350214 7:108476529-108476551 CTGTTTATAGGAATGTAAATTGG + Intronic
1030359274 7:108578778-108578800 CTGTGACTATTAAGATAAATGGG + Intergenic
1030877735 7:114836248-114836270 CTGCTTGTATGAATGTAAAATGG - Intergenic
1031322232 7:120345587-120345609 CTGTTTCTATGAATTTGACTAGG + Intronic
1039200696 8:35090190-35090212 CTGTGTCAATGAAGAGAAATAGG + Intergenic
1040821313 8:51561148-51561170 CTGTTGGTAGGAATGTAAATTGG + Intronic
1041520575 8:58751510-58751532 GTGTGTCTGGGAAAGTAAATAGG + Intergenic
1042014198 8:64289242-64289264 TTGTGTCTATGTATTTAAAGTGG + Intergenic
1042326271 8:67531577-67531599 CAGTGTATATAAATGTACATAGG - Intronic
1042714234 8:71754890-71754912 GTGTGTGTATTAATGTATATTGG + Intergenic
1043751334 8:83939626-83939648 CTGTTTGTGGGAATGTAAATTGG - Intergenic
1044797007 8:95911690-95911712 CTGCTGCTGTGAATGTAAATTGG - Intergenic
1044891792 8:96843732-96843754 CAATGTCTATGAATGTGAAATGG - Intronic
1045635664 8:104185772-104185794 CTGTTGATAGGAATGTAAATTGG + Intronic
1046040850 8:108902655-108902677 CTATGTCTATTAATTTAAACAGG + Intergenic
1046888341 8:119393800-119393822 ATGTGACTGTGAATGTAAATTGG + Intergenic
1046963163 8:120131314-120131336 CTGTTGGTAGGAATGTAAATTGG - Intronic
1047079133 8:121440755-121440777 CTGTTTCTGGGAATGTAAAATGG - Intergenic
1048103738 8:131384031-131384053 CTCTTTGTATAAATGTAAATGGG - Intergenic
1048134282 8:131731920-131731942 CTCTGTCTTTGTATTTAAATTGG - Intergenic
1051128960 9:13837288-13837310 CTGTGAGTAGGAATGTAAAATGG - Intergenic
1051176303 9:14364156-14364178 CTGTGGCTGTGAGTGTAAATGGG - Intronic
1051774202 9:20616964-20616986 CTGTGGGTGAGAATGTAAATCGG - Intronic
1051814048 9:21083592-21083614 CTGTTAGTAAGAATGTAAATTGG - Intergenic
1051999180 9:23255786-23255808 ATGTGTCCATGAATTGAAATGGG - Intergenic
1052511755 9:29431112-29431134 CTGTTGGTGTGAATGTAAATTGG - Intergenic
1052879255 9:33590720-33590742 CTGAGTCCCTGAATGTAAAAGGG - Intergenic
1053496723 9:38553499-38553521 CTGAGTCCCTGAATGTAAAAGGG + Intronic
1055178457 9:73351347-73351369 CTGTGGGTAGGAAGGTAAATTGG - Intergenic
1055940189 9:81642136-81642158 CTGTTCTTAGGAATGTAAATTGG + Intronic
1056567611 9:87788523-87788545 CTATGTCTATGTATTTTAATAGG + Intergenic
1058073966 9:100631668-100631690 CTGTGTTTTTCAGTGTAAATAGG + Intergenic
1058291927 9:103253190-103253212 ATGTGTCTATGAGTCTAAACGGG - Intergenic
1058631866 9:106997217-106997239 CTGTTGATAGGAATGTAAATTGG + Intronic
1059967445 9:119629315-119629337 GTGTGTGTATAAATGTATATGGG + Intergenic
1060154028 9:121306527-121306549 CTGTCTCTCTGAACGTATATAGG + Intronic
1203461304 Un_GL000220v1:41952-41974 CACTAACTATGAATGTAAATGGG - Intergenic
1185636994 X:1560019-1560041 CTGCGTCTTTGAATGCAACTAGG + Intergenic
1186369410 X:8931085-8931107 TTTTGTCTATTAATGAAAATAGG - Intergenic
1187371201 X:18707846-18707868 CTGTGGTTATGAATGAAAAGGGG + Intronic
1187482107 X:19667140-19667162 CTGTCTCTATGAATTTGACTAGG - Intronic
1188038926 X:25349713-25349735 TTGTTTCTAAGAATGTAAAATGG - Intergenic
1188703562 X:33297377-33297399 CTGTTTGTGGGAATGTAAATTGG + Intronic
1189863076 X:45293164-45293186 CTGTGTTTATGGCTGTAGATTGG + Intergenic
1190785164 X:53639905-53639927 CTGTTTCTGTGTCTGTAAATTGG - Intronic
1191208318 X:57857237-57857259 GTGTGTCTTTGCATGTAGATGGG - Intergenic
1192425683 X:71073893-71073915 GAGTGTCTATGCATGTTAATGGG + Intergenic
1193048158 X:77075001-77075023 GTGTGTCTCTGCATGTAAAATGG + Intergenic
1193212872 X:78828160-78828182 TTATGTCTTTGAATGTGAATTGG - Intergenic
1193282531 X:79670527-79670549 CTGTTGGTAGGAATGTAAATTGG - Intergenic
1193538924 X:82746999-82747021 TTGTGTGTATGTATGTATATGGG - Intergenic
1193657415 X:84215278-84215300 CTGTTTGTGGGAATGTAAATTGG + Intergenic
1194009683 X:88545818-88545840 CTGTGGCTGGGAATGTAAAATGG + Intergenic
1194141002 X:90209489-90209511 GTATGTCTAAGAATGTACATAGG - Intergenic
1194446963 X:94000394-94000416 CAGTAACTTTGAATGTAAATGGG - Intergenic
1194900385 X:99502558-99502580 CTGTGTATATGACAGTAAAGTGG - Intergenic
1195582375 X:106521982-106522004 CTGTTGGTAGGAATGTAAATTGG - Intergenic
1197923355 X:131619864-131619886 TTATTTCTCTGAATGTAAATTGG - Intergenic
1198494575 X:137178680-137178702 CTTATTCTGTGAATGTAAATTGG + Intergenic
1199143792 X:144340762-144340784 ATGTGTCTATGATTGCAAGTAGG - Intergenic
1201988091 Y:19991753-19991775 CTGTGTCTCTGAAGGTGAGTTGG + Intergenic