ID: 1020477028

View in Genome Browser
Species Human (GRCh38)
Location 7:8608252-8608274
Sequence CAGCTGTTCTCAGGGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020477023_1020477028 18 Left 1020477023 7:8608211-8608233 CCATAATAGATTAACTACTTAGC 0: 1
1: 0
2: 0
3: 16
4: 95
Right 1020477028 7:8608252-8608274 CAGCTGTTCTCAGGGATAAATGG 0: 1
1: 0
2: 0
3: 16
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020477028 Original CRISPR CAGCTGTTCTCAGGGATAAA TGG Intronic
900966780 1:5964311-5964333 CAGCTGTACCCATAGATAAAGGG - Intronic
901089233 1:6630332-6630354 CAGCTCTTCTCAGAAAGAAAAGG + Exonic
901889089 1:12246668-12246690 CAGGTGTTGTCTGGAATAAAGGG + Intronic
902111782 1:14085154-14085176 CTGTGGTTCTCAGAGATAAATGG - Intergenic
902744731 1:18466164-18466186 AAACTGTTCTCAGGGCTACAGGG - Intergenic
903009630 1:20320507-20320529 CAGCAGTTCTCAGAGCTCAATGG - Intronic
903920885 1:26799853-26799875 CAGCTGTTGGCAAGGAGAAAGGG - Intergenic
904714712 1:32458785-32458807 CAGCAGTTTTCAGGGAACAAGGG + Intergenic
905272557 1:36796419-36796441 CAGCTGGTCTCTGGGTCAAATGG + Exonic
907591388 1:55675530-55675552 CACATGTTCTCATGTATAAATGG - Intergenic
907693277 1:56692984-56693006 CAGTTTTTGTCAGGGGTAAAAGG + Intronic
909255402 1:73414384-73414406 CAGCTGCTCTAAGAGATTAATGG - Intergenic
910605644 1:89080658-89080680 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
910902504 1:92136568-92136590 CTGCTGTTATCAGAGATACAAGG + Intronic
911831042 1:102551525-102551547 CACATGTTCTCAGTCATAAATGG - Intergenic
911893729 1:103403565-103403587 CAGCTGGTTTCAGAAATAAAGGG - Intergenic
911943161 1:104073128-104073150 CAGCTCTTCTCAGAAAGAAAAGG + Intergenic
912218813 1:107648552-107648574 CAGCTATTCCCAGGGATGTAAGG + Intronic
912379754 1:109240918-109240940 CAGCTCTTCCCAGGTACAAAAGG + Intergenic
915676581 1:157537749-157537771 CAGCTGGTCTCAGAAATAAAGGG - Intronic
916290284 1:163158469-163158491 CAGCTGGTCTGAGAAATAAAGGG + Intronic
916626865 1:166567557-166567579 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
916949081 1:169760511-169760533 CAGTAGTTGTCAGGGATTAATGG - Intronic
918977785 1:191513055-191513077 CAGCAATTTTCAGGGAAAAAGGG + Intergenic
919279573 1:195470508-195470530 AAGCTGTTGCCAGGGCTAAATGG + Intergenic
919383325 1:196886363-196886385 CAGCTGGTCTGAGAAATAAAGGG + Intronic
920023065 1:202970146-202970168 CAGTTGTTGTCAGGATTAAATGG - Intergenic
920343028 1:205287516-205287538 CAGCTTTTCTCAGGCCGAAATGG + Intergenic
920521576 1:206631396-206631418 CAGCTGTTCCCAGGGAGTAGAGG - Intergenic
921681907 1:218043745-218043767 CAGCTGCTTTCAGGAAAAAAGGG + Intergenic
922000521 1:221473107-221473129 ATGCTGCTCTCAGGGATAAGAGG - Intergenic
923145867 1:231197234-231197256 CTGCTGTTCTCATTGATGAAGGG - Intronic
923345824 1:233051611-233051633 CAGATGTTCTCACTTATAAAAGG + Intronic
924120235 1:240790016-240790038 CAGCTGGTCTGAGAAATAAAGGG - Intronic
924358999 1:243215917-243215939 CAGCTGGTCTGAGAAATAAAGGG - Intronic
1062977467 10:1695344-1695366 CAGCTGTTCTCAGCATTAACAGG + Intronic
1066161936 10:32742997-32743019 CAGCACTACTCAGGGCTAAAAGG - Intronic
1066211242 10:33240888-33240910 CATCTGTTCTCAGGAATGATTGG - Intronic
1066518732 10:36192816-36192838 CAGTAGTTCTCAGGGGTTAAGGG - Intergenic
1066667716 10:37802372-37802394 CTCCTGTTCTTAGGGTTAAAGGG - Intronic
1067542995 10:47170047-47170069 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1067747566 10:48947741-48947763 AAGCTGTGCCCTGGGATAAAGGG - Intronic
1068676591 10:59775914-59775936 CACATGTTCTCACTGATAAATGG + Intergenic
1069185222 10:65414159-65414181 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1070508600 10:77139323-77139345 CAGCTCTTCTCTGTGATGAAGGG + Intronic
1070834319 10:79438390-79438412 CAGCCGGTCTCAGGGAGACAAGG + Intronic
1072376512 10:94822016-94822038 CACCTGTTCTCACTTATAAATGG - Intronic
1073738792 10:106382519-106382541 CAGATGTGCTCAGTGATAATGGG - Intergenic
1075728356 10:124622192-124622214 CAGCAGTCCTCAAGGACAAACGG + Exonic
1076196807 10:128524602-128524624 CAGCTGTTGTCAGGGAAACCAGG + Intergenic
1078919597 11:15817233-15817255 CAGCTGATCTCAGGGTTACTGGG - Intergenic
1079130616 11:17744906-17744928 CAGCTGTGCTGAGGGGTGAAGGG - Intronic
1080073847 11:28124264-28124286 TAGCTGTCCTAAGGGATTAAGGG - Intronic
1082977214 11:59085055-59085077 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1083011155 11:59400967-59400989 CAGCTGCTCTGAGAGATCAAAGG - Intergenic
1084859993 11:72011975-72011997 AAGCTGTACTCTGGGAAAAAGGG + Intronic
1085743195 11:79094304-79094326 GAGCTGCTGTGAGGGATAAATGG - Intronic
1085959420 11:81443173-81443195 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1086383979 11:86288401-86288423 CAGATTTACTCAGGGATTAAGGG - Intergenic
1087014162 11:93540183-93540205 CAGTTGTCCTCAGGGGGAAAAGG - Intronic
1087018586 11:93579141-93579163 CTGCTCTTATCAGGGTTAAATGG + Intergenic
1087054241 11:93918043-93918065 CTGCTATGCTCAGGAATAAAAGG + Intergenic
1087525001 11:99298064-99298086 CAGCTGCTCTGAGAGATTAAAGG + Intronic
1089084944 11:115809043-115809065 GAGCTGTCCCCAGGAATAAACGG + Intergenic
1089140102 11:116277795-116277817 CTGCTGTGCTCATGGATAAGTGG + Intergenic
1090789023 11:130074013-130074035 CTGAAGTTCTCAGGGGTAAAGGG - Intronic
1091144098 11:133262272-133262294 AATCTGTTCTCCAGGATAAATGG + Intronic
1091369939 11:135049372-135049394 CATCTGTCCCCAGGGATAATAGG + Intergenic
1091538516 12:1436763-1436785 CAGTTGGTCACAGGGAAAAATGG - Intronic
1092769607 12:11884770-11884792 CACCTGGTCTCAGGAACAAATGG - Intronic
1095848104 12:46769146-46769168 CAGAGCCTCTCAGGGATAAAGGG + Intronic
1098781113 12:74687654-74687676 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1100920573 12:99481253-99481275 CATATGTTCTCAGTTATAAATGG - Intronic
1101034643 12:100693406-100693428 CAGATATTCTTAGGGAAAAATGG - Intergenic
1101188256 12:102304724-102304746 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1102669149 12:114602311-114602333 CAGCTGTTCACAGGGGTAGTTGG + Intergenic
1102792567 12:115659584-115659606 TAGCTGTTCTCTGGGAGGAAAGG - Intergenic
1103202622 12:119100768-119100790 CAGCATTCCTCAGAGATAAATGG + Intronic
1103218040 12:119218654-119218676 CAGCTGGTCTGAGAAATAAAGGG + Intronic
1103235029 12:119365057-119365079 CAGGTGTTCTGAGGATTAAATGG - Intronic
1105506770 13:21016944-21016966 CATCTGTTCTCAGACATAAGAGG + Intronic
1108916850 13:55624350-55624372 CAGCAATTTTCAGGGAAAAAAGG - Intergenic
1109911836 13:68922914-68922936 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1110877697 13:80530225-80530247 CAAGTATTCTCAGGGATAAATGG - Intergenic
1111448345 13:88380032-88380054 CACCTGTTCTCACTTATAAATGG - Intergenic
1111680123 13:91431749-91431771 GAGCTGTTCTCAGAGAAAATGGG + Intronic
1112302203 13:98240441-98240463 CAGCTGTTCTGAGAGAAGAAGGG + Intronic
1112397958 13:99050769-99050791 CAGCTGCTCTAGGGGATAGATGG - Intronic
1112493132 13:99884792-99884814 CAGCTGGTCTCAGGGATATGGGG - Intronic
1113664932 13:112134895-112134917 CAGCTGTGCTCAGGGCTTAAGGG - Intergenic
1114482033 14:23042019-23042041 CAGCTGTCCTCTGAGATGAAGGG + Intergenic
1114876723 14:26729618-26729640 CAGGTGGTTTCAAGGATAAAAGG + Intergenic
1116235571 14:42275005-42275027 CAGCTGCTCTTAGAGATCAATGG + Intergenic
1116635435 14:47388718-47388740 AAGCTGGTCTCAGAGAAAAAGGG + Intronic
1116678597 14:47937978-47938000 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1117866084 14:60150814-60150836 CAGCTCTTTCCAGGTATAAATGG + Intronic
1118505080 14:66402428-66402450 CAGATGTTCCCAGGGATAGTGGG - Intergenic
1120033308 14:79667422-79667444 CAGCTGTGCACCGGGATGAATGG + Intronic
1120369538 14:83615073-83615095 CTGCTGTTCGCAGGGAGAGAGGG - Intergenic
1121116814 14:91349455-91349477 CTGCTGTTCAGAGGGAGAAACGG + Intronic
1122867301 14:104612813-104612835 CAGCTGTTCTCACTCATAAGTGG - Intergenic
1123217848 14:106828723-106828745 CATCTGTTCTCATGTATAAGTGG + Intergenic
1123845513 15:24297209-24297231 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1125335938 15:38626373-38626395 CAGGTGGTCTCTGGGATAAAGGG - Intergenic
1127163148 15:56213189-56213211 CTGCATTTCTCTGGGATAAATGG - Intronic
1127384041 15:58452975-58452997 CAGCTGTCCTTAGTGACAAATGG - Intronic
1128598750 15:68977178-68977200 CAGCTGGTCTGAGAAATAAAGGG + Intronic
1130931233 15:88429494-88429516 CTGCTCTTCTCTGGGACAAAGGG + Intergenic
1132054668 15:98641093-98641115 CAACTGTTCACAAGGATGAATGG - Intergenic
1134295543 16:12942185-12942207 CAACCCTTCTCAGGGATGAAGGG + Intronic
1136595375 16:31245413-31245435 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1137532094 16:49284232-49284254 CAGCTGTTGTCAGTGGGAAAGGG - Intergenic
1138163699 16:54779856-54779878 CATCTGTTCACAGGTACAAAAGG - Intergenic
1138954723 16:61957235-61957257 TAGCTGCTCTCAGGAATCAAAGG + Intronic
1141116302 16:81312960-81312982 CAGCTGCTCACAGGGATACTGGG + Intergenic
1142588605 17:990258-990280 CTGCTTTGCTAAGGGATAAAAGG - Intergenic
1142620247 17:1161055-1161077 CATCCCTTCTCAGGGATACAAGG + Intronic
1144045846 17:11453876-11453898 CAGTTGTTGCCAGGGATTAAGGG + Intronic
1145205038 17:20979893-20979915 CATCTGTCTTCAGAGATAAAGGG - Intergenic
1146142258 17:30378616-30378638 CAGGAGTTCTCAGAGAAAAATGG + Intergenic
1146436545 17:32854464-32854486 CAGTTCTTCTCTGGGCTAAAGGG + Intronic
1146892138 17:36513014-36513036 CTGGTTTTCTCAGGCATAAAGGG + Intronic
1148406659 17:47421358-47421380 CATGTGTACTCAGGGTTAAATGG + Intronic
1150106291 17:62464837-62464859 AGGCTGTTATCAAGGATAAATGG + Intronic
1151157451 17:72135818-72135840 CAGCTGTTTTCTGGGATTTAAGG + Intergenic
1152511776 17:80794881-80794903 CAGCTGTTGCCAGGGATTAGAGG + Intronic
1154365146 18:13701185-13701207 CAGCTGCTCTGAGGGATCAAAGG - Intronic
1154503576 18:15009859-15009881 CACATGTTTTCAGGTATAAATGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157686388 18:49646021-49646043 CAGCTCTCCCCAGGGACAAAGGG - Intergenic
1165150890 19:33759509-33759531 CAGCACTTCTCAGGGAAAGAGGG - Intronic
1166483400 19:43192405-43192427 TGGGTGTCCTCAGGGATAAATGG + Intronic
1166485869 19:43211492-43211514 TGGGTGTCCTCAGGGATAAATGG + Intergenic
1166493024 19:43275445-43275467 TGGGTGTCCTCAGGGATAAATGG + Intergenic
1167856107 19:52241470-52241492 CACATGTTCTCAGTTATAAATGG + Intergenic
1168723435 19:58567836-58567858 CTGCTGTTCTCAGAGAAATAAGG + Intronic
925048490 2:792808-792830 CTCCTGTTTTCAGGGATGAATGG - Intergenic
925288531 2:2731138-2731160 CAGCTGTTGCCAGAGAGAAAAGG + Intergenic
926115373 2:10209894-10209916 CAGCTGTGCCCCTGGATAAAAGG - Intronic
926353008 2:12014428-12014450 CAGCTGTTCTTAGGATTAATTGG - Intergenic
926859064 2:17290054-17290076 CGGCTGTTCTGAGAAATAAAGGG + Intergenic
927496019 2:23552500-23552522 CAGCTGGTCCCAGGGGTAATGGG - Intronic
928708419 2:33977209-33977231 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
929568156 2:43003117-43003139 CAACTGTTCTCAGGGCTCTAGGG + Intergenic
930408995 2:50999587-50999609 CAGCTGGTCTGAGAAATAAAGGG - Intronic
930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933611805 2:84444285-84444307 CAGCTGGTCTGAGAAATAAAGGG + Intronic
935751258 2:106235805-106235827 CAGCTATTTTCAGGGAAGAAGGG - Intergenic
935897420 2:107752877-107752899 CAGATGATCTCATGGATCAAGGG - Intergenic
936376015 2:111942107-111942129 CAGCTGGACTCAGGGAGACAGGG - Intronic
937069915 2:119055281-119055303 CAGCTATTTTCAGGGAACAAGGG - Intergenic
937925066 2:127161921-127161943 CAGCTGTTCCCAGGCATGAGCGG + Intergenic
938502750 2:131839990-131840012 CACATGTTTTCAGGTATAAATGG + Intergenic
939029881 2:137059534-137059556 CAGGGGTTCTCAGGGAGAGAGGG - Intronic
941244458 2:163079451-163079473 CAGGTGTTCTCTGGGTAAAATGG - Intergenic
942381647 2:175397961-175397983 CAGCTGGTATCTAGGATAAATGG + Intergenic
943846891 2:192661002-192661024 CAGCGATTTTCAGGGAAAAAAGG - Intergenic
944090539 2:195904935-195904957 CATCTGTTTTCAGGTATATATGG - Intronic
945357261 2:208855300-208855322 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
945488269 2:210424522-210424544 CAGCCGTTCTGAGAAATAAAGGG + Intergenic
947270383 2:228327737-228327759 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
948898917 2:240946241-240946263 CAGCTGATCTCAGGTATGCAAGG + Intronic
949003841 2:241634016-241634038 AAGCTGTTCAGAGGGATAACTGG - Exonic
1170455071 20:16524942-16524964 CAGATGTTCTCACTCATAAATGG + Intronic
1170872984 20:20224994-20225016 CAGATGTTCAGAGGGAGAAAAGG + Intronic
1171115047 20:22518362-22518384 TAGCTTTACTAAGGGATAAATGG - Intergenic
1177001319 21:15617015-15617037 AAGCTGTTATCAGGCATAATAGG + Intergenic
1181061425 22:20283853-20283875 CAGCTTGCCTCAGGGATAATTGG - Intergenic
1182264922 22:29107050-29107072 CAGCTGTTCTCAGCGAGGAAAGG + Intronic
1182485989 22:30639121-30639143 CAGCTGGTCTGAGAAATAAAGGG + Intronic
1182675179 22:32033758-32033780 CAGCTGTTTTCAGGGTACAATGG - Intergenic
1184107589 22:42377198-42377220 CACCTGTTCTTAGTGAAAAAGGG - Intergenic
949213583 3:1536784-1536806 CAGCTATTTTCAGGGAACAAGGG + Intergenic
949580083 3:5378864-5378886 CACCTGTTCTCACTGATAAGTGG - Intergenic
949638862 3:6013234-6013256 CAGCAATTTTCAGGGATCAAGGG + Intergenic
949638950 3:6013859-6013881 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
950019057 3:9773593-9773615 CAAATGTTCTCAGGGAAAAGGGG + Intronic
950198560 3:11026818-11026840 CAGCTGGTCTGAGAAATAAAGGG + Intronic
950605952 3:14080254-14080276 CAGCTGCTCTGAGAGATCAATGG + Intronic
950621776 3:14211763-14211785 CAGCAGTGCGCAGGGACAAAGGG + Intergenic
950699550 3:14731154-14731176 CAGTGGTTGTCAGGGATTAAGGG - Intronic
954471059 3:50695681-50695703 CAGCTGTTCTGAGAGAGGAATGG + Intronic
954995013 3:54873148-54873170 GAGCTGTTCTGAGGATTAAATGG + Intronic
955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG + Intronic
956141955 3:66155162-66155184 GAGCTGGTCTCTGGGCTAAAAGG - Intronic
956366242 3:68506114-68506136 CAGATGTTCTCACTCATAAATGG - Intronic
957105801 3:75884981-75885003 CACGTGTTCTCAGTTATAAATGG + Intergenic
957724383 3:84045696-84045718 CAGCTGCTCCCAGAGATCAATGG - Intergenic
959141218 3:102488776-102488798 CAGCTTTTCTCAGCTCTAAAGGG - Intergenic
960112795 3:113861854-113861876 CAGCTGGTCTGAGAAATAAAGGG + Intronic
960462882 3:117958668-117958690 CAGCTTTTCTCAGGGACTAGTGG - Intergenic
960588522 3:119343742-119343764 CACCTGGCCTCAGGGAGAAAAGG - Intronic
961110542 3:124279626-124279648 CAGCTGCTAGCAGGGAGAAAAGG + Intronic
961533618 3:127555781-127555803 CATCTGTTCACAGGAATACATGG + Intergenic
961936594 3:130591119-130591141 TAGATGTTTTTAGGGATAAATGG - Intronic
962662249 3:137614923-137614945 AAGTTGTGCTCAGTGATAAAGGG + Intergenic
962926237 3:139995729-139995751 CATCTGTGCTCAGGGGTAAAGGG + Intronic
966444889 3:179991007-179991029 CAGATTTTTTCAGGGATAATGGG - Intronic
967200529 3:187068851-187068873 CAGCTGTTTTCAGGGGAATAGGG + Intronic
968291310 3:197541863-197541885 CAGCTGTTCACAGGGATATTGGG - Intronic
968685169 4:1952988-1953010 CAGCTGCTCTCAAGGAGGAAAGG + Intronic
972897169 4:43637895-43637917 CAGCAGTTTTCAGGGAACAAGGG + Intergenic
974761346 4:66278274-66278296 CACATGTTCTCATGTATAAAAGG - Intergenic
975084421 4:70320506-70320528 TAACTGTTCTCATGGAAAAAAGG - Intergenic
977434722 4:96979378-96979400 CACCTGTTCTCACTGATAAGTGG + Intergenic
978505568 4:109452971-109452993 CAGCTGGTCTGAGAAATAAAGGG + Intronic
979191090 4:117859654-117859676 CAACTGTTCTCACTTATAAATGG + Intergenic
979342421 4:119542093-119542115 CAACTGTTCTCACGGAAAGATGG + Intronic
980200647 4:129652148-129652170 AAGCTCTGCTAAGGGATAAACGG + Intergenic
981233423 4:142386927-142386949 CAGCTGCTCTGAGAGATCAATGG - Intronic
981572325 4:146165825-146165847 CAGCTGTTTTCAAAGAAAAAGGG - Intergenic
984219487 4:176955602-176955624 CAGCTGTAGTCATGGCTAAAAGG - Intergenic
988266459 5:28957777-28957799 CAGCTGTTCCCAGTTATACATGG + Intergenic
989337220 5:40331872-40331894 CAGCTGCTCTGAGAGATCAATGG + Intergenic
989715230 5:44454835-44454857 CACCTGTAATCAGGGATACAAGG - Intergenic
990278065 5:54220716-54220738 CTGCTGATTTCAGAGATAAATGG - Intronic
990861119 5:60328840-60328862 CTCCTGTTTTCAGGGAAAAAAGG - Intronic
992566810 5:78004192-78004214 GAGCTGTTGTCAGGGCTAACTGG - Intronic
993076254 5:83235377-83235399 CCACTGTTCTCAGGGATGCAAGG + Intronic
993110515 5:83651594-83651616 AATCTGTCCTCAGGGGTAAAAGG + Intronic
993248408 5:85483073-85483095 CAGCTGCTCTGAGAGATCAAGGG - Intergenic
993367190 5:87048804-87048826 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
994561427 5:101378468-101378490 CACATGTTCTCACTGATAAATGG - Intergenic
997244776 5:132338131-132338153 CAGCTGGTCTGAGAAATAAAGGG + Intronic
997360933 5:133294414-133294436 AACCTGCTCTCAGGGAGAAAGGG + Intronic
998267181 5:140674862-140674884 CTGCTGTCCTCAGGGACAGAGGG + Intronic
999289008 5:150411470-150411492 CAGCTGTTGCCAGGCAGAAAGGG - Intronic
1000681518 5:164190809-164190831 TACCTGTTCTCAGGAATAATAGG + Intergenic
1002855933 6:1038297-1038319 CTGCTGTTCTCAGTGGTCAATGG + Intergenic
1003697404 6:8423957-8423979 CAGATTTTCTCAAAGATAAATGG + Intronic
1004202188 6:13559122-13559144 ATGCTGTTCTCAGAGAAAAAGGG - Intergenic
1005251393 6:23950253-23950275 CAGTTGTTGTCAGAGATTAAGGG + Intergenic
1005816767 6:29559426-29559448 TAGCTACTCTTAGGGATAAATGG - Intronic
1006505502 6:34486256-34486278 CAGCTGTGCTCTGAGAAAAAGGG - Intronic
1007519095 6:42437834-42437856 CAGTTGTTCTGAGGGTTAAAGGG + Intronic
1008044929 6:46842245-46842267 CAGCGATTTTCAGGGAAAAAAGG + Intergenic
1008341043 6:50364563-50364585 GAGCTGTTCTTGGGGATAGAAGG + Intergenic
1008418970 6:51274476-51274498 CAGCTGTTCTCAACCAGAAAAGG + Intergenic
1009215013 6:60911170-60911192 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1009715330 6:67385474-67385496 CAGATGTTTTCAGGGAGAAATGG - Intergenic
1010491773 6:76485439-76485461 CGGCTGGTCTGAGGAATAAAGGG + Intergenic
1012168542 6:95989737-95989759 CAGCGATTTTCAGGGAAAAAGGG + Intergenic
1012572843 6:100752059-100752081 CAGCTGTTCTTAAGGGTAAGAGG - Intronic
1013629193 6:111968903-111968925 CAGCTCTTCTCATGCAGAAATGG - Intergenic
1014111451 6:117622600-117622622 CAGCTGCTCTGAGAGATTAATGG - Intergenic
1014418974 6:121217559-121217581 CACATGTTCTCAGGTATAAGTGG + Intronic
1014469561 6:121798201-121798223 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1016884248 6:148944178-148944200 CAGTTGTTCTCACCTATAAATGG + Intronic
1017751589 6:157493957-157493979 CAGCTCTTGTCAGGCATTAAAGG - Intronic
1018786087 6:167109013-167109035 CTGGTGTTCTCAGTGAGAAATGG - Intergenic
1020477028 7:8608252-8608274 CAGCTGTTCTCAGGGATAAATGG + Intronic
1020603635 7:10307494-10307516 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1020658995 7:10960315-10960337 CACCTGTTCTCAGTCATAAGTGG - Intergenic
1023490382 7:40733260-40733282 GAGATGTTATCAGGGAGAAAGGG - Intronic
1024048678 7:45602385-45602407 GAGCTGAACTCAGGGATACAGGG - Intronic
1024213130 7:47224035-47224057 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1024403333 7:48949622-48949644 CAGCAATTCTCAGGGAACAAGGG - Intergenic
1025155201 7:56598992-56599014 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1027429177 7:78092504-78092526 CAGCTGTTCTCATGCATGGATGG - Intronic
1029547885 7:101220550-101220572 CAGCTGTTGTAAGGGTTAAATGG + Intronic
1030279158 7:107752260-107752282 CAGCTTTTCTAAGGTGTAAATGG + Intronic
1032035356 7:128517425-128517447 AGGCTGTTATCAAGGATAAATGG + Intergenic
1033716797 7:144010688-144010710 CAGCGGTTTTCAGGGAGCAAGGG - Intergenic
1034016556 7:147593937-147593959 AAGCTGTTTTCAGGAATAAATGG - Intronic
1034162032 7:149001119-149001141 CAGTGGGTCTCAGGGATAAGGGG - Intergenic
1034388799 7:150765861-150765883 GAACTGTTCTCAGGACTAAAAGG - Intergenic
1034541285 7:151759781-151759803 CAGCTGTTCTCAGGGCCAAGGGG + Intronic
1034844413 7:154431149-154431171 CAGCTGTTCTCAGGGCACCACGG - Intronic
1034882642 7:154774178-154774200 CAGCTGGTCCCAGGGACAACTGG + Intronic
1034929688 7:155151934-155151956 CAGCTGTTCTGAGACATAAAGGG - Intergenic
1035287870 7:157817565-157817587 CATCTGTCCTCAGGGAAAAGAGG + Intronic
1035684528 8:1513441-1513463 CAGCTGTTCCCAGGGAAAGGCGG - Intronic
1037068244 8:14610272-14610294 CTCCTGTTTTCAGGGAGAAAAGG - Intronic
1037331792 8:17750201-17750223 CAGCTGTTCTCATGGGTGATTGG - Intronic
1037865029 8:22436608-22436630 CAGCTATTCTCAGGGCATAAAGG - Intergenic
1038991941 8:32877750-32877772 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1039733727 8:40307324-40307346 CAGCTCTGCACAGGGTTAAAAGG + Intergenic
1040139442 8:43893545-43893567 CAGCTGATCTGAGAAATAAAGGG - Intergenic
1040140076 8:43899285-43899307 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1041378406 8:57225342-57225364 CAGCTGGTGCCAGGGAAAAATGG - Intergenic
1041988946 8:63961552-63961574 CAGATTTTCTCAGATATAAATGG - Intergenic
1042041957 8:64601410-64601432 CAGAGGTACTGAGGGATAAAGGG - Intronic
1042475462 8:69244341-69244363 CAGCTGATCTAAAGAATAAATGG + Intergenic
1042809418 8:72807321-72807343 AAGCTGTTTTCTGGGATACAAGG + Intronic
1042925769 8:73967039-73967061 GAGCTGTTCTGAAGAATAAATGG + Intronic
1042954544 8:74235224-74235246 CATTTGTTCTCAGGTAAAAACGG + Exonic
1044032977 8:87261272-87261294 CAGCTGCTCTGAGAGATCAATGG + Intronic
1044590299 8:93907879-93907901 CAGCTGGTCTGAGAAATAAAGGG + Intronic
1044925695 8:97206920-97206942 TAGCTGTTGTGAGAGATAAAAGG - Intergenic
1045635685 8:104186151-104186173 CACATGTTCTCAGTTATAAATGG + Intronic
1046496466 8:115020628-115020650 CAGTTGTGCTTAGGAATAAATGG + Intergenic
1046498695 8:115047160-115047182 CATATGTTCTCAGTGATATATGG + Intergenic
1046578850 8:116067088-116067110 CAGCTGCTCTGAGAGATCAATGG - Intergenic
1048623082 8:136156223-136156245 CAGCTCTTCTCATTGATAAATGG + Intergenic
1048742843 8:137581102-137581124 CAGCAGGCCTCAGGGAGAAACGG + Intergenic
1049799815 8:144512559-144512581 CACCTGTGCCCAGGGAAAAAGGG + Exonic
1050657658 9:7847028-7847050 CAGCTGCTCTGAGAGATCAATGG - Intronic
1050722722 9:8609165-8609187 CAGCTTTTCTCAGAGATTGAAGG - Intronic
1052083758 9:24238917-24238939 CAGCTGGTCTGAGAAATAAAAGG + Intergenic
1053077587 9:35147331-35147353 CATTTGTTCTCAAGTATAAAGGG + Intergenic
1055423679 9:76170811-76170833 CAGCAGAACACAGGGATAAAGGG + Intronic
1056251424 9:84752274-84752296 CAACTGTTCTCATGGAAAAGTGG - Intronic
1058288750 9:103211287-103211309 CAGCTGGTCTGAGAAATAAAGGG + Intergenic
1058549019 9:106093484-106093506 CAGCGATTTTCAGGGAAAAAGGG + Intergenic
1059036090 9:110755212-110755234 CAGCTTTTCTCACTGCTAAAAGG + Intronic
1062674084 9:137729766-137729788 CATTAGTTTTCAGGGATAAAAGG - Intronic
1185731650 X:2466549-2466571 CACCTGTTCTCACTCATAAACGG + Intronic
1188073305 X:25744584-25744606 CAGCTGCTCTGAGAGATCAATGG + Intergenic
1188435046 X:30149667-30149689 CAGCGATTTTCAGGGAAAAAGGG - Intergenic
1188823616 X:34803363-34803385 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1190977799 X:55424053-55424075 CACATATTCTCAGTGATAAATGG + Intergenic
1193853561 X:86570504-86570526 CACCTGTTCTCACTTATAAATGG + Intronic
1194403615 X:93467818-93467840 CAGGGGTTCTCAGGGATCCAAGG - Intergenic
1195040629 X:101010727-101010749 CATCAGTTCCCAGGAATAAAAGG + Intronic
1196271803 X:113720721-113720743 CAGCTATTTTCAGGGAACAAGGG - Intergenic
1199536405 X:148907460-148907482 CAGCTGGTCTGAGACATAAAGGG + Intronic
1199884250 X:152003310-152003332 CAGCTGGTCTGAGAAATAAAGGG - Intergenic
1201594546 Y:15653070-15653092 CAGCTGAGGTCAGGGGTAAAGGG - Intergenic