ID: 1020482400

View in Genome Browser
Species Human (GRCh38)
Location 7:8678488-8678510
Sequence AGCAACAACCAGAGGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 321}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020482400_1020482407 22 Left 1020482400 7:8678488-8678510 CCTAGCTTCCTCTGGTTGTTGCT 0: 1
1: 0
2: 3
3: 33
4: 321
Right 1020482407 7:8678533-8678555 GTTTGCTGGCTGTAGTGGATGGG No data
1020482400_1020482406 21 Left 1020482400 7:8678488-8678510 CCTAGCTTCCTCTGGTTGTTGCT 0: 1
1: 0
2: 3
3: 33
4: 321
Right 1020482406 7:8678532-8678554 TGTTTGCTGGCTGTAGTGGATGG No data
1020482400_1020482404 8 Left 1020482400 7:8678488-8678510 CCTAGCTTCCTCTGGTTGTTGCT 0: 1
1: 0
2: 3
3: 33
4: 321
Right 1020482404 7:8678519-8678541 CCAGCATTGGAGCTGTTTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 122
1020482400_1020482402 -5 Left 1020482400 7:8678488-8678510 CCTAGCTTCCTCTGGTTGTTGCT 0: 1
1: 0
2: 3
3: 33
4: 321
Right 1020482402 7:8678506-8678528 TTGCTCACTACAGCCAGCATTGG No data
1020482400_1020482405 17 Left 1020482400 7:8678488-8678510 CCTAGCTTCCTCTGGTTGTTGCT 0: 1
1: 0
2: 3
3: 33
4: 321
Right 1020482405 7:8678528-8678550 GAGCTGTTTGCTGGCTGTAGTGG 0: 1
1: 0
2: 2
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020482400 Original CRISPR AGCAACAACCAGAGGAAGCT AGG (reversed) Intronic
900861346 1:5234576-5234598 AGGAACAACTAGGGGAAGCCTGG - Intergenic
901424774 1:9175066-9175088 ACCAACAACCTGAGTGAGCTTGG + Intergenic
902945231 1:19831330-19831352 AGCCACAAGAAGGGGAAGCTGGG + Intergenic
903634903 1:24805765-24805787 TGCAACAATTGGAGGAAGCTGGG - Intronic
904156671 1:28489384-28489406 AGCATCTTCCAAAGGAAGCTTGG - Intronic
905340298 1:37273441-37273463 AGCAACAGCCAGAGGAAGCAGGG - Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
905982635 1:42244001-42244023 AGCAACAACAAGAGGAACTTTGG + Intronic
906031116 1:42720864-42720886 TGCAACTTCCAGAGGAGGCTTGG + Intergenic
907230859 1:52996890-52996912 AGCAACAGCAAAAGGAAGATAGG - Intronic
907446227 1:54509659-54509681 ACCAAGAACCAGCAGAAGCTGGG - Intergenic
907643294 1:56214433-56214455 AGAAACATCCAGAGGAAGGAAGG - Intergenic
908535564 1:65073423-65073445 AGCAGAAACAAGAGGAATCTGGG - Intergenic
909420998 1:75465218-75465240 ATCAACAACAAGAAGAATCTTGG + Intronic
909606068 1:77509403-77509425 AGCAACAGCCTGCTGAAGCTTGG + Intronic
911014078 1:93313290-93313312 ACCAATAACAAGAGGAACCTTGG + Intergenic
911041955 1:93598282-93598304 AGAAACCCCCAGAGGAGGCTGGG + Intronic
911478436 1:98403737-98403759 AGCAACAGGGAGAGGAAGGTAGG - Intergenic
911662013 1:100511523-100511545 GGTAACACCCAGAGGAAGCTGGG - Intronic
913446293 1:118954226-118954248 AGCAAGGATCAAAGGAAGCTTGG + Intronic
913962579 1:143351856-143351878 ACCAACAGCCAGAGCAACCTGGG - Intergenic
914056934 1:144177441-144177463 ACCAACAGCCAGAGCAACCTGGG - Intergenic
914122212 1:144788925-144788947 ACCAACAGCCAGAGCAACCTGGG + Intergenic
914244644 1:145876622-145876644 AGGCACAGCCAGAGGAGGCTGGG + Exonic
914506018 1:148289529-148289551 AGCAAGAAACAGAGGCAGCGAGG - Intergenic
914938986 1:152005631-152005653 AGCAACAATCAGAGTCACCTCGG - Intergenic
916117138 1:161495342-161495364 AGCAACCACCAGAATGAGCTTGG + Intergenic
917018786 1:170563532-170563554 AACAGAAACCAGAGGAAGCATGG - Intergenic
917396286 1:174597959-174597981 ATCAACAACAAGAGGAATGTTGG - Intronic
918380347 1:183947443-183947465 ATCAATAACCAAAGGAAACTTGG + Intronic
918881888 1:190134876-190134898 AGAAACCTCCAGAGGAGGCTGGG + Intronic
919308987 1:195881683-195881705 ATCAACAACAAGAGGAACTTTGG - Intergenic
920680630 1:208069744-208069766 AGATATAACCAGAGGAAGATAGG - Intronic
921076469 1:211703915-211703937 AGAAACCACAAGGGGAAGCTGGG - Intergenic
921113120 1:212058386-212058408 ATCAACAACAAAAGGAAGTTTGG + Intronic
922800347 1:228362148-228362170 GGTGAGAACCAGAGGAAGCTTGG - Intronic
923772278 1:236948059-236948081 AGGAAGAACAAGAGGAAGCGGGG + Intergenic
924823028 1:247512899-247512921 AGCACCCACCAGATGCAGCTGGG + Intronic
1064011208 10:11737921-11737943 AGCAGAGACCAGAGGAAGCGAGG - Intergenic
1064602389 10:17007083-17007105 AGCAACGACCAGAAGAGGCGAGG + Intronic
1065540915 10:26766291-26766313 AGAAACAACTAGAGGGAGCCAGG - Intronic
1065665501 10:28056071-28056093 AACAACAACCACAAAAAGCTTGG - Intronic
1065778480 10:29144392-29144414 AGAAACAACCAGTAGAAGCAGGG - Intergenic
1066657320 10:37708372-37708394 TGCCACAAGCAGAGGAAGGTTGG + Intergenic
1067658220 10:48213185-48213207 AGCACCAACCTGAGGATTCTTGG - Intronic
1068103672 10:52587888-52587910 AGCAATAACAAGAGGAATTTTGG - Intergenic
1068242629 10:54323855-54323877 AACATTAACCAGAGGAAGTTGGG + Intronic
1068708535 10:60104867-60104889 AACAATAACCATAGGAAGTTAGG + Intronic
1069586089 10:69603509-69603531 GGCAACTACCAGCAGAAGCTAGG - Intergenic
1069667798 10:70175334-70175356 AACAAAAACCAGAGCTAGCTGGG - Intergenic
1070393189 10:75988984-75989006 AGCAAGAAGCAGAGGTAGCTGGG - Intronic
1070851665 10:79568238-79568260 AGCAATAACAAGAGGAACTTTGG - Intergenic
1074447587 10:113533265-113533287 AGGCACAAGAAGAGGAAGCTGGG + Intergenic
1075368134 10:121911630-121911652 AGTAAAAACCAGAGCAACCTGGG + Intronic
1076436834 10:130452280-130452302 ATCAACAAACAGAGGAGGCGGGG - Intergenic
1078993042 11:16669223-16669245 ATCAATAACAAGAGGAATCTTGG + Intronic
1079031010 11:16986681-16986703 ACCAACAACCTGAGTAACCTTGG + Intronic
1079559196 11:21801821-21801843 AGCAACAACAAGAAAAAGCCTGG - Intergenic
1081233625 11:40618343-40618365 GGCAACCACCAGAAGAAACTAGG + Intronic
1081717966 11:45264520-45264542 AACAACCACAAGAGCAAGCTTGG + Intronic
1083652705 11:64212412-64212434 AACAGCACCCAGAGAAAGCTTGG - Intronic
1084105836 11:66979766-66979788 GCCAGCAACCACAGGAAGCTAGG - Intergenic
1085561883 11:77479234-77479256 GCCAACAACCTGAGGGAGCTTGG + Intergenic
1087800612 11:102499321-102499343 AGAGACAAGCAGAGCAAGCTTGG + Intergenic
1088120323 11:106361355-106361377 ATTAAGAACCAGAGGAGGCTGGG - Intergenic
1088137638 11:106577517-106577539 AGCCACAACCACAGGAAAATGGG - Intergenic
1088311249 11:108462964-108462986 AGCAACAACAACAAAAAGCTGGG + Intronic
1088574272 11:111254636-111254658 AGCTACAACCAGAGGTAGTATGG - Intergenic
1088681242 11:112243746-112243768 ATCAATAACAAGAGGAACCTTGG + Intronic
1090121095 11:124029171-124029193 GCCAACAACCACAAGAAGCTTGG + Intergenic
1090670510 11:128942135-128942157 ACCACCAACCACAGGTAGCTGGG + Intronic
1091565941 12:1648032-1648054 AGTATCAACCAAAGGAATCTGGG - Intergenic
1091828539 12:3533266-3533288 AGAATAAACCAGAGCAAGCTGGG + Intronic
1093934464 12:24985842-24985864 AGCAATAACCAAAGGATGCTGGG - Intergenic
1096043603 12:48542506-48542528 CGCTCCAACCAAAGGAAGCTGGG + Intergenic
1096774765 12:53957144-53957166 AGCAAGAACCAGAGTCTGCTTGG + Exonic
1098188610 12:67924512-67924534 GACAACAACCAGAGAAGGCTTGG + Intergenic
1098196171 12:68004371-68004393 GGGAAGATCCAGAGGAAGCTTGG - Intergenic
1098215599 12:68214163-68214185 ATAAACAACAAGAGGAATCTTGG - Intronic
1098389370 12:69952900-69952922 AGAAACAACCAGGGCATGCTGGG - Intronic
1098506688 12:71260658-71260680 AGAAGTAACCAGAAGAAGCTTGG + Intronic
1098861996 12:75720561-75720583 ACCACCACCCAGATGAAGCTGGG - Intergenic
1099504677 12:83458876-83458898 ACCAACAACCAGAGAAAGCTTGG - Intergenic
1101847452 12:108374062-108374084 GCCAACAACCAGAGCCAGCTTGG - Intergenic
1102131586 12:110534479-110534501 AGTAACAACCCATGGAAGCTTGG + Exonic
1103266080 12:119631406-119631428 AGGAACAACCAGTGGCAGCTGGG + Intronic
1103456646 12:121072282-121072304 GGCAAAATCCAGAGGAAACTAGG - Intergenic
1104349755 12:128034972-128034994 AGCAACAACAAGAAGAGGGTAGG + Intergenic
1105421126 13:20253367-20253389 AGCAAGAGCGAGAGGAAGCGGGG + Intergenic
1105691570 13:22845055-22845077 AACAACAGCTAAAGGAAGCTGGG - Intergenic
1106468674 13:30035803-30035825 AGCAACAGAGAGAGGAGGCTGGG - Intergenic
1107232345 13:38125052-38125074 AGCAACAAACAGGGGCAGCAAGG + Intergenic
1107338870 13:39384930-39384952 GTCAGCAACCAGAGGAAGGTGGG + Intronic
1107967246 13:45608347-45608369 AGCAGACACCAGAGGAATCTGGG + Intronic
1108903644 13:55444178-55444200 AGGAACAAACAGAGGAAGGAGGG - Intergenic
1109214656 13:59575071-59575093 ATCAATAACAAGAGGAACCTTGG + Intergenic
1109574048 13:64230057-64230079 AACAAAAACCATAGGGAGCTTGG + Intergenic
1110124620 13:71927347-71927369 AGCATCAGCCATAGAAAGCTGGG + Intergenic
1110161506 13:72383887-72383909 AGCAACAACCACAAGAAGGCTGG - Intergenic
1110397354 13:75046742-75046764 GCCAACAACCTGAGGAAGCTTGG + Intergenic
1111287157 13:86109865-86109887 AGCCATTACCATAGGAAGCTAGG - Intergenic
1111639674 13:90951727-90951749 AGCAAAACCCAGAGAAAACTGGG + Intergenic
1112407693 13:99135665-99135687 TTCAACAACCTGAGGAAGCTTGG + Intergenic
1115396888 14:32918795-32918817 AGCATCTACCAGCAGAAGCTGGG + Intergenic
1116021352 14:39465768-39465790 ATCAACAACAAGAGGAATTTTGG - Intergenic
1116140616 14:40989197-40989219 ATCAACAACAAGAGGAATATTGG - Intergenic
1116206213 14:41870164-41870186 ACCAACAACCTGAAGGAGCTTGG - Intronic
1116434492 14:44881226-44881248 ATCAATAACCAGAGGAATTTTGG + Intergenic
1117856949 14:60044597-60044619 ATCAATAACAAGAGGAACCTTGG - Intronic
1118393505 14:65316275-65316297 ACCAACAACCAGAGGGATCTTGG + Intergenic
1118505391 14:66405301-66405323 AGCAACAGCCAGAGACTGCTGGG + Intergenic
1118894039 14:69931091-69931113 AGAAAGAACCCGTGGAAGCTTGG - Intronic
1118959414 14:70515271-70515293 CGCAACAACCTGAGTGAGCTTGG - Intergenic
1119631309 14:76234662-76234684 GCCAACAACCTGAAGAAGCTTGG + Intronic
1119669885 14:76510276-76510298 AGCAATTTCCAGAGGAAGCTGGG - Intergenic
1120582871 14:86275511-86275533 AGCGACAACCAGTGGAATATTGG + Intergenic
1120716335 14:87844913-87844935 AGCAATAATCAAAGGAGGCTGGG + Intronic
1121774526 14:96582060-96582082 AGCAGCAAACAGAGAAAGGTGGG - Intergenic
1123720075 15:23052447-23052469 ATCAACAACAAGAGGAACTTGGG - Intergenic
1123846666 15:24310363-24310385 AGGAACAAACAAGGGAAGCTTGG + Intergenic
1124940812 15:34216024-34216046 AGCTACAAGCCGAGGAAGCTAGG - Intergenic
1127053455 15:55108563-55108585 AGTAAGAAACTGAGGAAGCTAGG + Intergenic
1127188208 15:56502803-56502825 ATCAATAACAAGAGGAACCTTGG + Intergenic
1128235234 15:66062517-66062539 GCCAACAACCAGAGGGACCTTGG + Intronic
1128329450 15:66746057-66746079 AGCATCAGCCAGAGGGTGCTGGG + Intronic
1128400278 15:67272217-67272239 ATCAATAACAAGAGGAACCTTGG - Intronic
1129958477 15:79661275-79661297 AGCAAAGACCAGAGGCAGCCAGG + Intergenic
1130315938 15:82796673-82796695 AGCAGCTAGCAGAGAAAGCTGGG - Intronic
1130878721 15:88036550-88036572 AGCAAGGAAAAGAGGAAGCTGGG + Intronic
1133036959 16:3038884-3038906 AGCAGCACCCAGGGGAGGCTGGG - Intergenic
1133360188 16:5168009-5168031 AGCAGCAACCAGACGGGGCTAGG + Intergenic
1133843564 16:9432897-9432919 ATCAACAACAAGAGGAACTTTGG - Intergenic
1135056328 16:19234870-19234892 GGCAACAACCACAGGCTGCTGGG - Intronic
1135191241 16:20356451-20356473 GTCCACAACCAGAGGAAGCAGGG - Intergenic
1136777833 16:32881141-32881163 AGCTCCCGCCAGAGGAAGCTAGG + Intergenic
1136892790 16:33980373-33980395 AGCTCCCGCCAGAGGAAGCTAGG - Intergenic
1138107508 16:54296735-54296757 ACCACCAAACACAGGAAGCTCGG - Intergenic
1141010925 16:80397867-80397889 ATCAACAACAAGAGGAATTTTGG + Intergenic
1141247218 16:82319243-82319265 AGCAATTACCAGAGGAATCTGGG - Intergenic
1203080248 16_KI270728v1_random:1143250-1143272 AGCTCCCGCCAGAGGAAGCTAGG + Intergenic
1142866818 17:2796360-2796382 AGCCTCACCCACAGGAAGCTCGG + Intronic
1144711582 17:17404837-17404859 GGCAACAACCAGAAGGTGCTGGG - Intergenic
1144847898 17:18229599-18229621 AGCAACAAACAGGTGAAGCAAGG - Intronic
1145242914 17:21250076-21250098 AGCAGCAGCTAGAGGGAGCTGGG + Intronic
1146058422 17:29592553-29592575 AGCAAGAACCAGAGTGAGGTTGG - Intronic
1147309120 17:39583844-39583866 ATTAATACCCAGAGGAAGCTAGG + Intergenic
1147455036 17:40531828-40531850 AGCAACCACTCGAGTAAGCTTGG + Intergenic
1148490887 17:48023604-48023626 AGCAACAAGCAGAGCCAACTGGG - Intergenic
1149389133 17:56171963-56171985 AGCAAATACCAAAGGATGCTGGG - Intronic
1149812243 17:59687680-59687702 AGCAACAATTATAGCAAGCTTGG - Intronic
1150500976 17:65650493-65650515 AGCAGCAAGCAGAGGCAGCTGGG - Intronic
1150918027 17:69456182-69456204 AGAAACATCCAGAGCAAACTGGG + Intronic
1152497698 17:80685782-80685804 TTCAACAGCCAGAGGCAGCTGGG - Intronic
1153833950 18:8947810-8947832 ACCAACAACCTGAGTGAGCTTGG + Intergenic
1153876914 18:9382200-9382222 AGAAAAAACAAGAGGAGGCTGGG + Intronic
1153986699 18:10357268-10357290 AGCAACAAGCCCAGGAAGCCAGG + Intergenic
1156859952 18:41824315-41824337 AGGGATAACAAGAGGAAGCTAGG + Intergenic
1157450246 18:47780861-47780883 AGCAACCACCTGAGTGAGCTTGG - Intergenic
1158045429 18:53149535-53149557 AGCAAGTACCACAGGCAGCTTGG - Intronic
1159894085 18:73980307-73980329 ATCACTAACCAGAGGATGCTAGG - Intergenic
1160411053 18:78675675-78675697 AGAAACAAACAGAGGAAGGGTGG - Intergenic
1160657209 19:279724-279746 AGTAAGGAGCAGAGGAAGCTCGG - Intergenic
1160731307 19:642818-642840 AGCAACACCACGAGGAAGGTTGG - Intronic
1162224682 19:9210776-9210798 AGCAACAATCAGAAGCTGCTGGG + Intergenic
1162499129 19:11041445-11041467 AGCAAGAAGCAGAAGAAGCGCGG + Exonic
1165017639 19:32893705-32893727 AGCAATAACAAGAGGAACTTTGG + Intronic
1165145947 19:33730282-33730304 AGAAACAGTCAGAGGAAGCAAGG + Intronic
1167754945 19:51406643-51406665 ATCAAGAAACAGAGGAGGCTGGG + Intergenic
1202696417 1_KI270712v1_random:130114-130136 ACCAACAGCCAGAGCAACCTGGG - Intergenic
925773726 2:7310762-7310784 AGCAGCAACCATAGGAAAATTGG - Intergenic
926045063 2:9704126-9704148 GGCCACAGCCAGAGAAAGCTGGG - Intergenic
926504924 2:13702098-13702120 AGCAACAACAAAAGGAATCTGGG - Intergenic
927107388 2:19839861-19839883 AGCAAGAACCAGATCATGCTGGG - Intergenic
927151144 2:20196893-20196915 TCCAGGAACCAGAGGAAGCTAGG + Intergenic
928535254 2:32233589-32233611 ACCAATAACCAGAGGAACTTTGG - Intronic
930651559 2:53970110-53970132 AGGAAGAACCGGAGGAAGCAAGG + Intronic
932226761 2:70047581-70047603 ACCAACTACCAGAGGCAGCTGGG + Intergenic
932630827 2:73341815-73341837 TGCAACAACCTGTGGGAGCTTGG + Intergenic
933586209 2:84182079-84182101 CTCAACAACCCGAGGCAGCTTGG + Intergenic
934036515 2:88092857-88092879 TGTAACAACCACAGGAATCTAGG + Intronic
934277580 2:91587139-91587161 ACCAACAGCCAGAGCAACCTGGG - Intergenic
935276451 2:101479890-101479912 AGGAACAAGCAGAGGCAGGTGGG - Intergenic
935817863 2:106864070-106864092 AGTAAAAGCCAGAGGAGGCTGGG + Intronic
937528449 2:122799658-122799680 GGAAACCACCAGAAGAAGCTAGG - Intergenic
938940805 2:136168086-136168108 AGCAAGAAAGGGAGGAAGCTTGG + Intergenic
938995062 2:136669684-136669706 AGCAGGAAACAGTGGAAGCTAGG - Intergenic
940197086 2:151106684-151106706 CGCAAGTACCAAAGGAAGCTGGG + Intergenic
941848346 2:170153844-170153866 GCCAACAACCTGAGGAAGTTTGG - Intergenic
942883024 2:180885606-180885628 ATCAACACCCAGAGGAACTTTGG + Intergenic
943366021 2:186968155-186968177 AGCAGTAACCAGAGGAAACTTGG - Intergenic
943938248 2:193954828-193954850 AGGTACAGCCATAGGAAGCTAGG + Intergenic
944080550 2:195783427-195783449 AGCTACAACTAGAGGAGGCTGGG - Intronic
946890472 2:224270592-224270614 AGTTACAACTGGAGGAAGCTGGG + Intergenic
947209167 2:227691103-227691125 ATCAACAACAAGAGGAATTTTGG + Intronic
947876008 2:233468728-233468750 CACCACAACCAGAGGAAGCCAGG + Intronic
947988104 2:234465947-234465969 AGTAACAATAAGAGGAAGCTGGG + Intergenic
948312623 2:237000037-237000059 AGCACCAACCAGAGGATGAGGGG + Intergenic
1169066414 20:2696595-2696617 AGCATCATGCAGAGGAGGCTGGG - Intronic
1171515116 20:25724671-25724693 ATCAACAGCAAGAGGAACCTTGG - Intergenic
1172406973 20:34697063-34697085 TCCAACATCCAGAGGGAGCTTGG - Intronic
1173756766 20:45523306-45523328 AGACACAACCAGAGGAAGATGGG - Intergenic
1174691137 20:52506461-52506483 ATCAACAACAAGAGGAACTTTGG + Intergenic
1175693657 20:61084884-61084906 ACCAACAACCCGAGTGAGCTTGG + Intergenic
1177498837 21:21924191-21924213 AGCAACCACCAGAAGAGGCAAGG + Intergenic
1179148997 21:38794535-38794557 ATCAACACCCAGAGGACGCCAGG + Intergenic
1181929507 22:26388793-26388815 AGCAACTACCAAAGGAATATGGG + Intergenic
1182360431 22:29743407-29743429 AGGAAAAATCAGAGGAAACTAGG - Intronic
1184491137 22:44809757-44809779 AGGAAAACCCAGAGGAATCTAGG - Intronic
951040832 3:17987425-17987447 AGAAAAAACCAGAGGATTCTGGG + Intronic
952018450 3:28987887-28987909 TGCAACAACCACCTGAAGCTAGG - Intergenic
952040694 3:29258018-29258040 AACAACAACCAGATGAACCTTGG - Intergenic
952935984 3:38398685-38398707 AGTAACAAACAGAGGAAGGAAGG - Intronic
953111664 3:39946654-39946676 GACAACAACCTGATGAAGCTTGG + Intronic
955485615 3:59431692-59431714 AACAACATCCAGAGGAAGAAGGG + Intergenic
955574957 3:60350977-60350999 GTCAACAACCTGAGGGAGCTTGG + Intronic
956262335 3:67357890-67357912 GCCAACAACCTTAGGAAGCTTGG - Intergenic
956476394 3:69624973-69624995 AGCAATAACAAGAGGAATTTTGG + Intergenic
959096535 3:101962702-101962724 GGCAACCACCAGAAGAAGCTAGG - Intergenic
959492602 3:107008557-107008579 ATCAACAACAAGAGGAACTTTGG + Intergenic
960451822 3:117819141-117819163 ATCAGCAACCAGAGAAATCTGGG + Intergenic
960870233 3:122240863-122240885 ATCAATAACAAGAGGAAGTTTGG + Intronic
961450593 3:127000609-127000631 AGCACCTGCCAGAGGAACCTTGG - Intronic
961482343 3:127192230-127192252 ATCAGCACCCAGAGGCAGCTGGG + Intergenic
961488266 3:127232725-127232747 TGCAACCACTAGGGGAAGCTGGG - Intergenic
961653743 3:128430178-128430200 AGCAAGAAACAGAAGGAGCTGGG + Intergenic
962024211 3:131529782-131529804 ACCAACAACCGGAGTGAGCTTGG + Intergenic
963686562 3:148442400-148442422 ACCAACAACCTGAGGAAGCTTGG - Intergenic
963763027 3:149304413-149304435 ATCAACAACAAGAAGAATCTTGG - Intergenic
964437692 3:156672034-156672056 AGCAACAAGCTAAGGATGCTGGG - Intergenic
965535280 3:169817242-169817264 AGCAATAACAAGAGGAAATTTGG - Intergenic
965874303 3:173298999-173299021 AGCCACAACCATAGGAAAATGGG - Intergenic
967021745 3:185528866-185528888 AACAACAACAAGAAAAAGCTGGG + Intronic
967216266 3:187213115-187213137 AGCACCAACCAGAGCAAGCCTGG - Intergenic
969033163 4:4229209-4229231 ACCAACAGCCAGAGCAACCTGGG + Intergenic
969072082 4:4547616-4547638 ACCAGAAACCAGAGGAAGCAAGG + Intergenic
970660979 4:18285435-18285457 AGCAACAACCAGACCCAGATAGG - Intergenic
971063928 4:23005708-23005730 GCCAACAACCTGAGGGAGCTTGG - Intergenic
971304456 4:25467473-25467495 ATCAACAACAAAAGGAAACTGGG - Intergenic
973062581 4:45746361-45746383 AGCAAAATCCAGAGGAAGCGAGG - Intergenic
974151506 4:58016074-58016096 ATCAACATCCAGACCAAGCTTGG + Intergenic
974349303 4:60724068-60724090 AGCAAGCACCAGAAGAATCTGGG - Intergenic
974893030 4:67905051-67905073 AGCAATAACAAGAGGAATTTGGG - Intergenic
976722475 4:88182583-88182605 ATCAACAACAAGAGGAATTTTGG + Intronic
976736048 4:88311151-88311173 ATCAACAACAAGAGGAATTTTGG - Intergenic
977669324 4:99677668-99677690 AGAAATAAGCAGAGGAAGTTGGG - Intergenic
978270012 4:106877583-106877605 GCCAACAACCTGAGGGAGCTTGG + Intergenic
978725337 4:111962812-111962834 AGCAAAGACCTGAGGAAGCAAGG - Intergenic
979879224 4:125933338-125933360 AGTAATAACAAGAGGAATCTTGG + Intergenic
980909869 4:138984191-138984213 AGCAGACACCAGAGGAATCTGGG - Intergenic
983878603 4:172906610-172906632 GCCAACAACCAGAGCCAGCTTGG - Intronic
985094047 4:186394429-186394451 CTCAACAACCACCGGAAGCTGGG - Intergenic
985337440 4:188911855-188911877 AGTAACACCCAGAGGAAGGCAGG + Intergenic
987449566 5:18064987-18065009 ACCAACAACCTGAGTGAGCTTGG + Intergenic
987459332 5:18189204-18189226 ATCAATAACCAGAGAAATCTTGG - Intergenic
987926611 5:24350302-24350324 AGCAGGCACCAGAGGAATCTGGG + Intergenic
988236654 5:28554339-28554361 ATCAACAACCAGAGGAATTTTGG - Intergenic
988682622 5:33498558-33498580 AGCAGGCACCAGAGGAATCTGGG - Intergenic
989059215 5:37393661-37393683 ATCAATAACAAGAGGAACCTTGG - Intronic
990596034 5:57313449-57313471 GGCAACCACCAGAAGAAGCTAGG + Intergenic
991029024 5:62063332-62063354 AGGAAGAAGCAGAGAAAGCTTGG + Intergenic
991537349 5:67685055-67685077 ATCAACAACAAGAGGAATTTTGG - Intergenic
992646544 5:78816841-78816863 GCCAACAACCTGAGCAAGCTTGG + Intronic
994661187 5:102656429-102656451 AGCCACAAAAAGAGGAGGCTGGG + Intergenic
995606224 5:113858548-113858570 ATCAATAACAAGAGGAACCTTGG - Intergenic
995643313 5:114282281-114282303 AGCAAAAAACAAAGGAATCTAGG + Intergenic
995903829 5:117099959-117099981 GTCAACAAACTGAGGAAGCTTGG + Intergenic
996223141 5:120957440-120957462 ATCAATAACCAGAAGAACCTTGG - Intergenic
998900139 5:146844430-146844452 AGCAAGAATCCAAGGAAGCTAGG - Intronic
999286362 5:150396581-150396603 AGCAAGAAGAAGAAGAAGCTGGG + Exonic
999406024 5:151307735-151307757 ATCAACAACAAGAGGAAGTTTGG - Intergenic
1000682208 5:164199265-164199287 GGCAACAATATGAGGAAGCTTGG - Intergenic
1001544601 5:172563277-172563299 AGCAAGAACCAGGGGAGGGTTGG + Intergenic
1002783571 6:384656-384678 AGCATTAACCACAGGAAGCCAGG + Intergenic
1002813931 6:660578-660600 AGCCACATCCACAGGAAGATGGG + Intronic
1003598560 6:7496734-7496756 TGGAGCAACCAGGGGAAGCTGGG + Intergenic
1004012931 6:11706404-11706426 AGCTGCTAACAGAGGAAGCTGGG + Intergenic
1004202725 6:13564606-13564628 AACAACAACAAAAGGAGGCTAGG - Intergenic
1004646063 6:17561782-17561804 AACAACAACCAGAGCAATCCTGG + Intergenic
1005486604 6:26306354-26306376 AGAAACAACCAAAGAAAGGTTGG - Intergenic
1007371008 6:41427257-41427279 AGCAACAAGCCAAGGAAGGTAGG - Intergenic
1010303464 6:74288417-74288439 AGGAACAATTAGAGGAATCTAGG + Intergenic
1012717534 6:102695795-102695817 ATCAATAACAAGAGGAAGTTTGG - Intergenic
1014186615 6:118442034-118442056 ATCAACAACAAGAGGAATTTTGG - Intergenic
1014989671 6:128058059-128058081 AGCAACAACCAGTAGTAGATTGG - Intronic
1016760436 6:147730370-147730392 AACAACAAACAGAAGAGGCTTGG + Intronic
1017384223 6:153864191-153864213 ATCAATAACAAGAGGAAGTTTGG + Intergenic
1017438459 6:154440235-154440257 AGAAACAACCAGAAAAAGCACGG + Intronic
1019264831 7:109079-109101 AGGAAGACCCAGAGGAAACTCGG + Intergenic
1019901952 7:4027941-4027963 AGCAACAAGCAGGGGAAGAATGG + Intronic
1020182052 7:5930295-5930317 AGGAACAACCAGAGAAATCCAGG + Intronic
1020300882 7:6794641-6794663 AGGAACAACCAGAGAAATCCAGG - Intronic
1020482400 7:8678488-8678510 AGCAACAACCAGAGGAAGCTAGG - Intronic
1021288121 7:18807732-18807754 ATCAATAACCAGAGGAAAATTGG - Intronic
1021922728 7:25502858-25502880 AACAACAACCACATGTAGCTGGG - Intergenic
1023706120 7:42943438-42943460 AGCAATAGCTAGAGGAAGATAGG + Intronic
1023991771 7:45132958-45132980 TCCAACTACCAGAGGGAGCTGGG + Intergenic
1025040268 7:55636995-55637017 AACAATAACAAGAGGAACCTTGG - Intergenic
1026948272 7:74330222-74330244 AGAAACACCAAGAGGAAGCTAGG - Intronic
1027808550 7:82861805-82861827 AGAAATAACCAGAGGAATTTTGG + Intronic
1028656010 7:93207788-93207810 AGAGACATCCAGAGGCAGCTGGG + Intronic
1029196689 7:98810415-98810437 AGCCAGAGCCAGAGAAAGCTGGG + Intergenic
1030966537 7:115999172-115999194 ATCAACAACAAAAGGAATCTTGG + Intronic
1032082884 7:128868978-128869000 AGCAATGACCAGAGGGTGCTGGG + Intronic
1032821908 7:135531615-135531637 AGTATCAGCCAGGGGAAGCTGGG - Intergenic
1033008166 7:137590129-137590151 TGCAAATAGCAGAGGAAGCTGGG + Intronic
1033861231 7:145630618-145630640 AGGAAGAATCAGAAGAAGCTGGG - Intergenic
1036786609 8:11692203-11692225 GGCAACAACCAGAGGGAGGAAGG + Intronic
1037508824 8:19561390-19561412 ACCAACAAGCACAGGAAGCTAGG + Intronic
1038365041 8:26922989-26923011 ATGAAGAACCAGAGGAAGATGGG + Intergenic
1038891885 8:31734678-31734700 AGTAACATCCAGAGAAAACTGGG - Intronic
1041717112 8:60942476-60942498 ACCAACAACCTGAGTGAGCTTGG - Intergenic
1041802471 8:61814728-61814750 AACAACTACCAGAAGAAGCTAGG + Intergenic
1043109657 8:76164420-76164442 AACAACAAGAAAAGGAAGCTAGG - Intergenic
1043120517 8:76316985-76317007 AACAACAACCAGAAGAAACAAGG + Intergenic
1043811165 8:84742604-84742626 AGCAAGAATCAGAGGAAACTGGG + Intronic
1045791795 8:105992115-105992137 GGCAACAACCTGAGTTAGCTTGG + Intergenic
1046030183 8:108774361-108774383 ATTAACAACCAGAGTAATCTTGG + Intronic
1046851781 8:118982724-118982746 ACTGACAACCAGAGGAAGTTGGG - Intergenic
1047910396 8:129521872-129521894 ATCAAGAACAAGAGGAATCTTGG + Intergenic
1048546983 8:135396456-135396478 AGCAACAGCTGGAGGAAGATCGG + Intergenic
1049205204 8:141360471-141360493 AGAGACAGCCAGACGAAGCTGGG - Intronic
1050253874 9:3773905-3773927 AGCACTAACCAGTGGAAGCCTGG - Intergenic
1052215200 9:25958721-25958743 ATCAATAACAAGAGGAAGTTTGG + Intergenic
1053129986 9:35609312-35609334 GGCCACAGCCAGAGGCAGCTGGG - Exonic
1054697973 9:68380278-68380300 ATCAATAACAAGAGGAATCTTGG + Intronic
1055034845 9:71807358-71807380 AGCAAAAATCAGACCAAGCTGGG + Intronic
1058789501 9:108428348-108428370 TGCTAAAACTAGAGGAAGCTAGG - Intergenic
1058942115 9:109822982-109823004 ACCAGAAAGCAGAGGAAGCTAGG - Intronic
1059780554 9:117521873-117521895 AGCCATAAACAGAGGAAGCTGGG - Intergenic
1060087630 9:120715700-120715722 AGCAGCTTCCAGAGGAAGCCAGG + Intergenic
1061641738 9:131963432-131963454 AGCAGCAAGCAGAAGAAGATGGG + Intronic
1062158874 9:135068943-135068965 TGCACCATCCAGAGGAAGCGAGG + Intergenic
1062729225 9:138099803-138099825 AGCAACAACAATAGGAAGGCTGG - Intronic
1186537327 X:10363698-10363720 ACCAACAACCTGAGGAAACTTGG - Intergenic
1186559743 X:10598739-10598761 GCCAACAACCAGAGCGAGCTTGG + Intronic
1187043903 X:15626311-15626333 GACAACAACTGGAGGAAGCTTGG - Intergenic
1189836822 X:45032214-45032236 TGCAACCAACAGAGGCAGCTAGG - Intronic
1190281334 X:48932646-48932668 AGAAAGAAAAAGAGGAAGCTGGG + Intronic
1190946994 X:55104938-55104960 ATCAATAACAAGAGGAACCTTGG + Intronic
1192097866 X:68232361-68232383 GGCAAAATGCAGAGGAAGCTAGG + Intronic
1192168304 X:68839662-68839684 AGCAACATCCAATGGAAGCCTGG + Exonic
1192810596 X:74543779-74543801 GCCAACAACCTGAGGGAGCTTGG + Intergenic
1192891389 X:75395044-75395066 ATCAATAACAAGAGGAAGTTTGG + Intronic
1193028257 X:76869535-76869557 AGCAATAACAAGAGGAATTTTGG + Intergenic
1194117785 X:89923930-89923952 AGCTAAAACCTGAGGAATCTAGG + Intergenic
1194592355 X:95815052-95815074 AGCAGCAACCATAAGAAGCTAGG - Intergenic
1194870494 X:99125709-99125731 AGGAAGAACCCGATGAAGCTAGG + Intergenic
1195214195 X:102681621-102681643 ATCAACAACAGGAGGAATCTTGG - Intergenic
1195236784 X:102907670-102907692 ATCAATAACAAGAGGAACCTGGG + Intergenic
1195389974 X:104351371-104351393 AGCAACAAACAAGGGAACCTGGG + Intergenic
1195799817 X:108695302-108695324 AGCAGGAACCAGGGGAGGCTAGG - Exonic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1197035843 X:121871502-121871524 AGCAACACCCTAAGGAACCTGGG + Intergenic
1197355108 X:125429972-125429994 ATGAACAACCTGAGGAAGCTTGG - Intergenic
1197677380 X:129345081-129345103 AGCAATAACAAGAGGAAATTTGG + Intergenic
1197968906 X:132094407-132094429 AGAAACCACCAGAGGATGATTGG - Intronic
1200470566 Y:3581083-3581105 AGCTAAAACCTGAGGAATCTAGG + Intergenic
1200928436 Y:8675327-8675349 AGCCAGACCCAGAGAAAGCTAGG - Intergenic