ID: 1020484307

View in Genome Browser
Species Human (GRCh38)
Location 7:8702836-8702858
Sequence CAGAAAAGTTTCATGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020484307_1020484310 28 Left 1020484307 7:8702836-8702858 CCTGACTCCATGAAACTTTTCTG 0: 1
1: 0
2: 2
3: 19
4: 199
Right 1020484310 7:8702887-8702909 ATTATCCAACTATTGCCTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 138
1020484307_1020484309 27 Left 1020484307 7:8702836-8702858 CCTGACTCCATGAAACTTTTCTG 0: 1
1: 0
2: 2
3: 19
4: 199
Right 1020484309 7:8702886-8702908 CATTATCCAACTATTGCCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020484307 Original CRISPR CAGAAAAGTTTCATGGAGTC AGG (reversed) Intronic
900198563 1:1390695-1390717 CAGTAAAGTTTACTGGAGGCTGG + Intronic
902114249 1:14107859-14107881 CAGGTAGGTTTCTTGGAGTCAGG - Intergenic
903059177 1:20657557-20657579 TAGAAAAGCTCCAAGGAGTCTGG + Intronic
903597229 1:24503591-24503613 CAGACAAGTTTCAAGAAGTTAGG - Intronic
904189945 1:28736176-28736198 CACAAAACTTTCAAGGAGTCCGG - Intergenic
906556939 1:46721647-46721669 CAGAAATGGTTCTTGAAGTCAGG - Intergenic
907466758 1:54643016-54643038 CAGAAAACATTCACGGAGTGAGG - Intronic
909915061 1:81307156-81307178 CAGAAAAGTTTAATGTAGCAAGG + Intronic
910842872 1:91577706-91577728 CAGTAATGTTTCAGGAAGTCTGG - Intergenic
911815154 1:102340659-102340681 TTGAAAAGTTTCATGGACTTAGG + Intergenic
912990417 1:114480942-114480964 AAAAAAAGATTCTTGGAGTCCGG + Intronic
913181825 1:116329830-116329852 CAGAAAAGTAGAAGGGAGTCTGG + Intergenic
915889225 1:159756154-159756176 AAGAGAAGTTGCATTGAGTCGGG + Intergenic
917464624 1:175265001-175265023 CAGAGAAGTTACATGAAGTAAGG + Intergenic
917485342 1:175450229-175450251 CAGGAAAGATTCATGGTCTCTGG + Intronic
919052381 1:192526734-192526756 AATATAAGTTTCATGAAGTCAGG + Intergenic
921732130 1:218590456-218590478 CAATAAAGGTTCATGGAGTGAGG + Intergenic
922668196 1:227490440-227490462 CAGAAAAGCTCCCCGGAGTCAGG + Intergenic
924353349 1:243141761-243141783 CAGAACATTTTCATAAAGTCTGG - Intronic
1062977719 10:1697823-1697845 AAGAGAAGTTGCAGGGAGTCGGG - Intronic
1063320670 10:5049905-5049927 CTGGAAAGTTCCATGGAGTCAGG - Intronic
1063326234 10:5105888-5105910 CTGGAAAGTTCCATGGAGTCAGG - Intronic
1063336206 10:5217015-5217037 CTGGAAATTTCCATGGAGTCAGG - Intronic
1064728186 10:18302245-18302267 CAGGGAAGTTTGATGGGGTCAGG + Intronic
1065384633 10:25122562-25122584 AAGAAAAGTTTTCTGGACTCTGG - Intergenic
1068635965 10:59348627-59348649 AAAAAAAGATTCATGAAGTCTGG - Intronic
1068965830 10:62911413-62911435 CAGAAAAGCTTGAGGGAGTTAGG - Intronic
1071563433 10:86659734-86659756 CAGAAAACTTTCTGGAAGTCAGG + Intronic
1072158008 10:92741335-92741357 GAGAAAAGTTACAAGGAGGCTGG + Intergenic
1072678110 10:97483912-97483934 GAAAAAAGTTTCATGCTGTCTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080660007 11:34288049-34288071 GAGAAAATTTTCATGGATTTGGG - Intronic
1080910124 11:36588483-36588505 CAGATTAGTTTCTGGGAGTCAGG + Intronic
1081762038 11:45583377-45583399 CAGAATGGTTTCATGATGTCTGG - Intergenic
1082953586 11:58845047-58845069 GAGAAAAGTTTCAGGGGGACTGG + Intronic
1082969988 11:59010306-59010328 GAGAAAAGTTTCAGGGGGACTGG + Intronic
1084204546 11:67584099-67584121 AAGAAAAGTTTGCTGGAGCCCGG - Intronic
1087355149 11:97083508-97083530 CACAAAAATTTTATGGATTCTGG + Intergenic
1088753840 11:112868724-112868746 CATAAAATTTTCATAAAGTCTGG + Intergenic
1089347756 11:117801946-117801968 CAGAGAGGTTCCATGTAGTCCGG + Intronic
1089606143 11:119642500-119642522 GAGAGAAGTTTCCTGGAGGCAGG - Intronic
1090220706 11:125021251-125021273 CAGAAAAGTTTCAGGAAGGAGGG + Intronic
1090644195 11:128754346-128754368 CAGAAAGGTTTCATGGAAACAGG + Intronic
1091457612 12:619398-619420 CTGAAGAGCTTCATGGAGTGGGG + Intronic
1092370503 12:7913156-7913178 CAGGAAGGCTTCATGGAGTGTGG - Intergenic
1094174968 12:27531835-27531857 CAGAAGAGTTCCAAGTAGTCTGG - Intronic
1095731878 12:45514780-45514802 CAGACACTTTCCATGGAGTCTGG + Intergenic
1097738752 12:63213238-63213260 CAGAAAAGTTTCCTGTAATAAGG - Intergenic
1098493679 12:71111095-71111117 CAGAAAAGCTTCATACAGTAGGG + Intronic
1099446740 12:82761727-82761749 CAGAAAACCTTCATGAAATCTGG - Intronic
1099717979 12:86321421-86321443 CTGAAAAGTTTCATTTGGTCTGG - Intronic
1102902298 12:116647780-116647802 CACAGAAGTCACATGGAGTCGGG - Intergenic
1103471953 12:121189360-121189382 CGCAAATGTTTCATGGAGTAGGG - Intergenic
1104084894 12:125465529-125465551 CAGGAAAGTATCTTAGAGTCTGG + Intronic
1106562082 13:30855569-30855591 CAGAAAAGTTCCCAGGAGTCTGG + Intergenic
1106812109 13:33368846-33368868 CAGAAGAGTTTCCTGGAGGCCGG - Intergenic
1108785503 13:53896181-53896203 GAAAAAAGTTTCATTTAGTCAGG + Intergenic
1110303080 13:73952146-73952168 CAGAAAAGTTACTTGGAGTCAGG + Intronic
1110799396 13:79677366-79677388 AAGAAAATTTTCCTTGAGTCTGG - Intergenic
1111657166 13:91168091-91168113 CAGAAAAGTTTAATAAAGTCAGG - Intergenic
1112470242 13:99681880-99681902 CAGAAAAGATGCAAGGAGGCAGG - Intronic
1112797774 13:103075766-103075788 CAGGAGAGTTTCATGAGGTCAGG + Intergenic
1114083016 14:19218195-19218217 CAGAGGAGTATCGTGGAGTCTGG - Intergenic
1115425307 14:33252202-33252224 ATGAAAACTTTCATGGAATCAGG + Intronic
1117653892 14:57934607-57934629 CAGAAAGGCTGCATAGAGTCAGG + Intronic
1118333449 14:64832206-64832228 AAGAATAGCTTCATGGAGTGAGG - Intronic
1119494990 14:75070442-75070464 CAGAAAAGTTTAAGGGAATGTGG + Intronic
1119859614 14:77926747-77926769 GACAAGAGTCTCATGGAGTCTGG + Intronic
1121041131 14:90748982-90749004 GAGAGAAATTTCATGGAGTATGG + Intronic
1122658111 14:103275444-103275466 CAGAAGATTTTCATGAACTCTGG - Intergenic
1124408132 15:29410213-29410235 CAGAAAAGTTTCAGAGAGAAAGG - Intronic
1124918555 15:34000595-34000617 CAGAATTGTTTCAAGGAGTATGG + Intronic
1127343989 15:58076118-58076140 CAGAAAAGGTACATGGAATCAGG - Intronic
1127386148 15:58468780-58468802 TAGCAGAGTTCCATGGAGTCTGG - Intronic
1127500638 15:59550825-59550847 AAGGAAATTTTTATGGAGTCAGG - Intergenic
1130771276 15:86926291-86926313 CAGAAAAGATTTATGTAGTGAGG - Intronic
1131059139 15:89393701-89393723 CAGAAAAGTAGCATTGAGCCAGG + Intergenic
1134309473 16:13062631-13062653 CAGAGGAGTTTCCTGGAGTAGGG + Intronic
1137510012 16:49090907-49090929 CAGATAAGTATCAAGGAGGCAGG - Intergenic
1141073353 16:80978783-80978805 CTTAAAAGCTTCATGGAGGCTGG + Intronic
1145744006 17:27299675-27299697 CAGAAAAGTATGATGAAGTTAGG + Intronic
1149264328 17:54911195-54911217 AAGAAAAGTTTCCTGGAGGATGG - Intronic
1149523954 17:57339796-57339818 TGGAAAAGTTTCTGGGAGTCAGG - Intronic
1150059778 17:62056588-62056610 AAAAAAAGTTTTTTGGAGTCAGG - Intronic
1152848937 17:82619997-82620019 AAGAAAAGTTGCAGGGAGTGGGG + Intronic
1153482254 18:5558480-5558502 CACAAAAGTATAATGGTGTCTGG - Intronic
1154499721 18:14989870-14989892 CAGAGGAGTATCCTGGAGTCTGG - Intergenic
1156163031 18:34383219-34383241 CAGAAGAGATTGATGGAGGCAGG - Intergenic
1156539573 18:37896331-37896353 CTGAAAAGTTGCCTGGAGTTTGG + Intergenic
1159435230 18:68407854-68407876 CAAGTAATTTTCATGGAGTCAGG + Intergenic
1162510728 19:11116630-11116652 CAGAAAAACTTCAAGGAGGCTGG - Intronic
1163789145 19:19296143-19296165 AAAAAAAGTTTTATGGAGACGGG - Intronic
1165200889 19:34143942-34143964 TAGAAAAGATTCATGGAATAAGG - Intergenic
1166830535 19:45636973-45636995 CAGAGCAGTTTCATGGGGTCAGG - Intronic
1168667154 19:58212729-58212751 CAGAAAAGTATCTTGGGTTCCGG - Exonic
927168183 2:20345949-20345971 GAGAAAATATTCATGGAGTATGG - Intronic
927382954 2:22499987-22500009 CAGAAAAGTTTGAAGGATTATGG + Intergenic
932626046 2:73296608-73296630 CACAAAAGTTCTATGGAGTAAGG + Intergenic
936877324 2:117206544-117206566 CAGAAAAAATTAATGGAGTTGGG + Intergenic
938493561 2:131778442-131778464 CAGAGGAGTATCGTGGAGTCTGG + Intergenic
938498930 2:131820223-131820245 CAGAGGAGTATCGTGGAGTCTGG - Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939028709 2:137044860-137044882 CAGAATAGTGACATGGATTCAGG - Intronic
939261130 2:139810821-139810843 CTGAAAACTTTCAGGGAGTAAGG + Intergenic
939763215 2:146211055-146211077 CAGAAAAGTTTCCAGGAGCTTGG + Intergenic
939891505 2:147742334-147742356 CAGAGAAGTTTTAAGGAGTTAGG + Intergenic
941133943 2:161689929-161689951 CAGAAAAGTTTTGAGGAGTCTGG - Intronic
941333821 2:164214281-164214303 CAGAAAAGATTCCATGAGTCAGG - Intergenic
941822908 2:169860331-169860353 CAGATAAGTTACTTGGACTCAGG + Intronic
942196145 2:173522158-173522180 CAGAAATGTTTTATGGAGGAGGG + Intergenic
943434165 2:187843160-187843182 AAGAAAGTTGTCATGGAGTCTGG + Intergenic
944501866 2:200369541-200369563 CAGAAAAGTGTCAGGAAGCCTGG + Intronic
945649038 2:212537632-212537654 CAGACAAGTTTGAAGGACTCCGG + Intronic
947215543 2:227746370-227746392 CAGAAAAGTGCCATGAAGTCTGG - Intergenic
948782861 2:240334228-240334250 CAGAAATGTATCATTGAGCCTGG - Intergenic
1171441267 20:25165269-25165291 AAGAAAAGTTTCTTTGACTCTGG + Intergenic
1173986531 20:47266020-47266042 CTGCAAAGCTTCATGGAGTCAGG + Intronic
1177416931 21:20806181-20806203 CAGAAAGGTGAAATGGAGTCAGG - Intergenic
1177799446 21:25813486-25813508 CAGAAAATTTTCATGATGTTAGG + Intergenic
1177886083 21:26747374-26747396 CAGAAGAGTTTGATGAGGTCAGG + Intergenic
1178789540 21:35687294-35687316 GAGAAACCTTTCATGGAGTTGGG - Intronic
1179235848 21:39545163-39545185 CAAAAAAGTTTCCTTGACTCTGG + Intergenic
1180497763 22:15904486-15904508 CAGAGGAGTATCGTGGAGTCTGG + Intergenic
951303546 3:21028489-21028511 CAGCAAAGTGAGATGGAGTCTGG + Intergenic
952497013 3:33924820-33924842 CAGAAATGTTTCATGCTGTCAGG + Intergenic
957270881 3:78028796-78028818 CAGAAATGTTACAAGGATTCAGG + Intergenic
957557125 3:81777094-81777116 CAGTTAAGTTACATGGAATCAGG - Intergenic
958833232 3:99114875-99114897 CAGAACAGTTTCCTGTACTCAGG - Intergenic
961100337 3:124193171-124193193 CAGCCAACTTTCATGGAGCCTGG - Intronic
963896996 3:150697600-150697622 CAATAAAGTTTCAAGGAGGCAGG - Intronic
964014033 3:151925100-151925122 AAGAAAGGATTCATGGAATCTGG - Intergenic
965246960 3:166284983-166285005 CAGAGAAGAGTTATGGAGTCTGG + Intergenic
965681136 3:171252886-171252908 CAGAAAATTTAAATGGAGTAGGG + Intronic
966461053 3:180176749-180176771 CAGAAAACTGTCATGGAGTGGGG + Intergenic
968177053 3:196559722-196559744 CAGAAAAGTTTCTTGGTTTGGGG - Intronic
970731301 4:19107123-19107145 CAAAAAAGGGTCATTGAGTCAGG - Intergenic
971693079 4:29863408-29863430 AAGAAAAGTTTCCTTGACTCTGG - Intergenic
971854576 4:32026758-32026780 AACAAAAATTTCATGGGGTCTGG - Intergenic
972483134 4:39516830-39516852 GGGAAAAGTTTTATAGAGTCAGG + Intronic
975179251 4:71324716-71324738 CAAAAACGTTACATGGATTCAGG - Intronic
977295824 4:95207881-95207903 CAGAGAAATTTCAGGAAGTCAGG - Intronic
977465176 4:97374848-97374870 CAGAGAAGCTTCATGGTGTGAGG + Intronic
977648032 4:99436910-99436932 CAATCAAGTTTCATGGAGACTGG - Intergenic
978729889 4:112013354-112013376 CAGAAAAGATACATGGGGCCAGG + Intergenic
980328765 4:131383839-131383861 CAGAAAACTTCCATGGAATCTGG - Intergenic
980421146 4:132563271-132563293 CATAAAAGTTTCATGAAATGAGG - Intergenic
981246081 4:142540347-142540369 CAGGAAGGTTTCATTGAGCCTGG - Intronic
982400756 4:154965187-154965209 AATAAAAGCTTCATGAAGTCAGG + Intergenic
983133145 4:164046828-164046850 CAGAGAAGTTTCATGGAAAAAGG + Intronic
983783750 4:171705874-171705896 CAGAAAAGTAGCATGGAGGGAGG - Intergenic
986494216 5:8326243-8326265 CAGAAAAATTTCTTGGACCCAGG - Intergenic
987048166 5:14126871-14126893 GAGAAAACTTGCATGGAGTTGGG + Intergenic
987738993 5:21880826-21880848 AGAGAAAGTTTCATGGAGTCAGG + Intronic
988055972 5:26097244-26097266 CAGAAAAGTTTGCTGGAGTCTGG - Intergenic
990252278 5:53928199-53928221 CAGAAAAGGTTCCTGGAGAAGGG + Intronic
990341637 5:54829081-54829103 AAAAAATGTTTCATGGAGACTGG + Intergenic
990990417 5:61678310-61678332 CAGAGAAGTTCCATGGGGTGTGG - Intronic
992543917 5:77791848-77791870 CAGAAAAGTTTAAAGAATTCAGG - Intronic
994090933 5:95808984-95809006 CAGAAAAGTCGCCTGGAGACAGG + Intronic
994995992 5:107063752-107063774 CAGCACAGTTTCATGGATGCTGG - Intergenic
997119860 5:131163131-131163153 CATAAGACTTCCATGGAGTCCGG - Intronic
997545470 5:134703122-134703144 CAGAAAAATTTCAAGTAGACTGG - Intronic
998398182 5:141833117-141833139 CAGAAGAGTTTGGTAGAGTCAGG + Intergenic
1001184111 5:169551076-169551098 CTGAAAATTATCATGGAGTCAGG + Intergenic
1001953849 5:175834575-175834597 CAGAAAAGTTTTGTGGAGCTGGG + Intronic
1004490644 6:16111726-16111748 CAGGAAGGGTTCATGAAGTCGGG - Intergenic
1006036176 6:31214509-31214531 TAGCAAAGTTTTATGGAGACGGG - Intergenic
1008216787 6:48800812-48800834 CAGAATGGTTGCATGGAGCCAGG + Intergenic
1008545953 6:52583614-52583636 CACAAAAGTTTAGTGGAATCAGG + Intergenic
1010050326 6:71496650-71496672 CAGAAAAATTTTGTGGAGTGGGG - Intergenic
1010223223 6:73465603-73465625 TAGAAAGGTTTCATGGGGTAAGG + Intronic
1010987568 6:82442637-82442659 GAGAGAAGTTTGCTGGAGTCAGG + Intergenic
1012946198 6:105468540-105468562 CAGAAAAGTTTCTTAGAGGGAGG - Intergenic
1012947531 6:105483814-105483836 GAGCAGAATTTCATGGAGTCTGG + Intergenic
1015370062 6:132440362-132440384 AAGAACACTTTCATGGGGTCTGG - Intergenic
1018051768 6:160015581-160015603 CAGTACAGTTTCATGAAGTAGGG - Intronic
1018751384 6:166809517-166809539 CAGAAAAGTTGCATAGGGTGTGG + Intronic
1020484307 7:8702836-8702858 CAGAAAAGTTTCATGGAGTCAGG - Intronic
1020725361 7:11806729-11806751 TAGAAAAGGTTCATGGACACTGG + Intronic
1024097427 7:45994190-45994212 CAGAAAGGTCGCAGGGAGTCAGG + Intergenic
1024205030 7:47150885-47150907 CAGGTATGTTTCATGGAGTGGGG - Intergenic
1026580579 7:71613018-71613040 CAGAAACGTCTACTGGAGTCTGG - Intronic
1031216277 7:118897148-118897170 TAGCAATGTTTCATGGAGTCAGG - Intergenic
1031846705 7:126813704-126813726 CATACAAGTTTCATGGAGAATGG - Intronic
1032416959 7:131743184-131743206 CTGAAAAGCTTCATGGATTGGGG - Intergenic
1034633688 7:152550630-152550652 CAGAAAAGAAACATGGGGTCTGG + Intergenic
1036218058 8:6897202-6897224 CAGGAGAGTTTCATGCAGCCTGG + Intergenic
1036622523 8:10434144-10434166 TAGAACAGTTTTATGGAGGCTGG - Intergenic
1036811614 8:11870742-11870764 CAGGAAAGCTTCATGGAGAAAGG + Intergenic
1037619888 8:20554536-20554558 CAGAACAGTTCCATCGTGTCGGG + Intergenic
1038923676 8:32114061-32114083 TAGAATAGTTTCATGTAGTTGGG + Intronic
1042346831 8:67736146-67736168 CAGGAAAGTGAGATGGAGTCAGG - Intronic
1044082633 8:87904194-87904216 CAGCAAATATTGATGGAGTCTGG - Intergenic
1047238701 8:123065480-123065502 CTGAAAAGTTTCATGGATCCAGG - Intronic
1047805247 8:128352599-128352621 GAGAAATGTTTCCTGGAGTCAGG - Intergenic
1048587985 8:135792828-135792850 GAGAGAAGTGTCATGGTGTCAGG + Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1050343689 9:4665503-4665525 CAGGAAATTGTCATGGAATCTGG - Intronic
1050801968 9:9626601-9626623 CTTAAAAGTTTCACAGAGTCAGG + Intronic
1054727974 9:68671451-68671473 CAGCCAAGTTTCATGGATGCTGG - Intergenic
1055220877 9:73929648-73929670 CAGAAAAGTTTCAGGAAGATGGG - Intergenic
1055428307 9:76218103-76218125 CAGCAGAGTTTCATCAAGTCAGG - Intronic
1055998153 9:82184391-82184413 CTGAAAAGTTTCAGGGGGACAGG - Intergenic
1058978909 9:110151092-110151114 CAGAAAAGTTCCCTGGAAGCTGG + Intronic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1185665901 X:1765386-1765408 CAGAAAAGTTGCCTGCAGTTTGG - Intergenic
1187781682 X:22833534-22833556 CACCAAAGTTTCCTGGTGTCTGG - Intergenic
1188343414 X:29033662-29033684 TGGAATAGTTTCAAGGAGTCAGG + Intronic
1189417850 X:40830903-40830925 CACTACAGTTTCATGGAATCTGG + Intergenic
1190439171 X:50460163-50460185 CAGAAAGTTTTCATGAACTCTGG - Intronic
1193313395 X:80036056-80036078 TAGAAAAGTATCATGGTGACAGG - Intergenic
1194320936 X:92445599-92445621 AAGAAAAGTTTAAAGGAATCAGG + Intronic
1195487173 X:105422649-105422671 AAGAAAAGTTTCCTTGACTCTGG + Intronic
1197225082 X:123948948-123948970 CAGAAAAGGATTCTGGAGTCGGG - Intergenic
1197282386 X:124552521-124552543 CAGAAAAGTTTAATGGTATGTGG - Intronic
1198745257 X:139883274-139883296 CTCAAAAGTTTCATGAAGCCTGG + Intronic
1198807612 X:140506052-140506074 AAGAAAAGTTTCTTGGAGGGGGG + Intergenic
1199716533 X:150510939-150510961 CAGACAAGTTTCAGGAAGGCTGG + Intronic
1199911131 X:152288054-152288076 CAGAAATCCTTCATGCAGTCAGG + Intronic
1200629050 Y:5558755-5558777 AAGAAAAGTTTAAAGGAATCAGG + Intronic
1201610421 Y:15836964-15836986 CTGAAAATTTTCTTGGAGTTTGG - Intergenic