ID: 1020495092

View in Genome Browser
Species Human (GRCh38)
Location 7:8841189-8841211
Sequence GATACTAATGTGCAAACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020495091_1020495092 21 Left 1020495091 7:8841145-8841167 CCTGAATATAATAATAAACTCAG No data
Right 1020495092 7:8841189-8841211 GATACTAATGTGCAAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020495092 Original CRISPR GATACTAATGTGCAAACACC AGG Intergenic
No off target data available for this crispr