ID: 1020497203

View in Genome Browser
Species Human (GRCh38)
Location 7:8870768-8870790
Sequence TTTTGCCAATTCTACCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020497203_1020497206 28 Left 1020497203 7:8870768-8870790 CCCAAAAGGTAGAATTGGCAAAA No data
Right 1020497206 7:8870819-8870841 AGTGAGATTTACAAAACTCCTGG No data
1020497203_1020497205 -7 Left 1020497203 7:8870768-8870790 CCCAAAAGGTAGAATTGGCAAAA No data
Right 1020497205 7:8870784-8870806 GGCAAAACTCTCAAAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020497203 Original CRISPR TTTTGCCAATTCTACCTTTT GGG (reversed) Intergenic
No off target data available for this crispr