ID: 1020497296

View in Genome Browser
Species Human (GRCh38)
Location 7:8871907-8871929
Sequence TGTAATCACGATTTGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020497290_1020497296 26 Left 1020497290 7:8871858-8871880 CCAAAGTAAAATCTTGCGTAAGA No data
Right 1020497296 7:8871907-8871929 TGTAATCACGATTTGGCAAAGGG No data
1020497292_1020497296 2 Left 1020497292 7:8871882-8871904 CCTGGTCTTTAAATATAGCTCAT No data
Right 1020497296 7:8871907-8871929 TGTAATCACGATTTGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020497296 Original CRISPR TGTAATCACGATTTGGCAAA GGG Intergenic
No off target data available for this crispr