ID: 1020506398

View in Genome Browser
Species Human (GRCh38)
Location 7:8994263-8994285
Sequence CATTATATGCAAAAAGTATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020506398_1020506400 4 Left 1020506398 7:8994263-8994285 CCCTATACTTTTTGCATATAATG No data
Right 1020506400 7:8994290-8994312 AGCTTTTGCCATTCATTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020506398 Original CRISPR CATTATATGCAAAAAGTATA GGG (reversed) Intergenic
No off target data available for this crispr