ID: 1020506818

View in Genome Browser
Species Human (GRCh38)
Location 7:9000930-9000952
Sequence CTCAACTGGTCCCCAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020506818_1020506821 2 Left 1020506818 7:9000930-9000952 CCAGGATTTGGGGACCAGTTGAG No data
Right 1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG No data
1020506818_1020506820 -5 Left 1020506818 7:9000930-9000952 CCAGGATTTGGGGACCAGTTGAG No data
Right 1020506820 7:9000948-9000970 TTGAGACAAAAATACACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020506818 Original CRISPR CTCAACTGGTCCCCAAATCC TGG (reversed) Intergenic
No off target data available for this crispr