ID: 1020512338

View in Genome Browser
Species Human (GRCh38)
Location 7:9073411-9073433
Sequence TTGGAGAAGCTGAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020512338_1020512343 -7 Left 1020512338 7:9073411-9073433 CCCTCCTGCCTCAGCTTCTCCAA No data
Right 1020512343 7:9073427-9073449 TCTCCAATAACTAGGATAACAGG No data
1020512338_1020512345 -4 Left 1020512338 7:9073411-9073433 CCCTCCTGCCTCAGCTTCTCCAA No data
Right 1020512345 7:9073430-9073452 CCAATAACTAGGATAACAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020512338 Original CRISPR TTGGAGAAGCTGAGGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr