ID: 1020513578

View in Genome Browser
Species Human (GRCh38)
Location 7:9089802-9089824
Sequence GTCTGCAGGCCTCTGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020513578_1020513581 -3 Left 1020513578 7:9089802-9089824 CCTCACAACAGAGGCCTGCAGAC No data
Right 1020513581 7:9089822-9089844 GACCTACATGGAGAGCTATGTGG No data
1020513578_1020513582 -2 Left 1020513578 7:9089802-9089824 CCTCACAACAGAGGCCTGCAGAC No data
Right 1020513582 7:9089823-9089845 ACCTACATGGAGAGCTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020513578 Original CRISPR GTCTGCAGGCCTCTGTTGTG AGG (reversed) Intergenic
No off target data available for this crispr