ID: 1020537640

View in Genome Browser
Species Human (GRCh38)
Location 7:9421848-9421870
Sequence ACTTTGGCCTGGGTGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020537640_1020537645 19 Left 1020537640 7:9421848-9421870 CCTTTTATCACCCAGGCCAAAGT No data
Right 1020537645 7:9421890-9421912 TCACTATAACTTCAAACTCCTGG 0: 9
1: 185
2: 1202
3: 4468
4: 19884

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020537640 Original CRISPR ACTTTGGCCTGGGTGATAAA AGG (reversed) Intergenic
No off target data available for this crispr