ID: 1020539344

View in Genome Browser
Species Human (GRCh38)
Location 7:9440554-9440576
Sequence GGGCATTCAATTAGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020539340_1020539344 8 Left 1020539340 7:9440523-9440545 CCAGGGCAATCAGGCAGGAGAAG 0: 2758
1: 5884
2: 4851
3: 4196
4: 4617
Right 1020539344 7:9440554-9440576 GGGCATTCAATTAGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020539344 Original CRISPR GGGCATTCAATTAGAAAAAC AGG Intergenic
No off target data available for this crispr