ID: 1020543593

View in Genome Browser
Species Human (GRCh38)
Location 7:9493730-9493752
Sequence CTGCTGGTCATGGGCAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020543593_1020543602 22 Left 1020543593 7:9493730-9493752 CCTGTTCTGCCCATGACCAGCAG No data
Right 1020543602 7:9493775-9493797 AGATGAGTGTGGCAAGCCTTGGG No data
1020543593_1020543603 23 Left 1020543593 7:9493730-9493752 CCTGTTCTGCCCATGACCAGCAG No data
Right 1020543603 7:9493776-9493798 GATGAGTGTGGCAAGCCTTGGGG No data
1020543593_1020543601 21 Left 1020543593 7:9493730-9493752 CCTGTTCTGCCCATGACCAGCAG No data
Right 1020543601 7:9493774-9493796 TAGATGAGTGTGGCAAGCCTTGG No data
1020543593_1020543604 29 Left 1020543593 7:9493730-9493752 CCTGTTCTGCCCATGACCAGCAG No data
Right 1020543604 7:9493782-9493804 TGTGGCAAGCCTTGGGGAATAGG No data
1020543593_1020543598 11 Left 1020543593 7:9493730-9493752 CCTGTTCTGCCCATGACCAGCAG No data
Right 1020543598 7:9493764-9493786 TAAAGCCACCTAGATGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020543593 Original CRISPR CTGCTGGTCATGGGCAGAAC AGG (reversed) Intergenic
No off target data available for this crispr