ID: 1020551778

View in Genome Browser
Species Human (GRCh38)
Location 7:9615770-9615792
Sequence GCATCAGAGGGCTCCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 4, 2: 2, 3: 17, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020551770_1020551778 29 Left 1020551770 7:9615718-9615740 CCATCTGGAGAAACCTGCCAAAT 0: 6
1: 15
2: 16
3: 186
4: 1304
Right 1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG 0: 1
1: 4
2: 2
3: 17
4: 103
1020551772_1020551778 12 Left 1020551772 7:9615735-9615757 CCAAATATGATGACATCAAGTAG 0: 1
1: 11
2: 17
3: 23
4: 157
Right 1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG 0: 1
1: 4
2: 2
3: 17
4: 103
1020551771_1020551778 16 Left 1020551771 7:9615731-9615753 CCTGCCAAATATGATGACATCAA 0: 11
1: 12
2: 12
3: 18
4: 178
Right 1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG 0: 1
1: 4
2: 2
3: 17
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020551778 Original CRISPR GCATCAGAGGGCTCCCTCAA GGG Intergenic
900994444 1:6112846-6112868 GGTCCAGAGGGCACCCTCAAGGG + Intronic
901448004 1:9319797-9319819 GGATGTGAGGGCTCACTCAAAGG - Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
902637315 1:17743230-17743252 GCATCAGGCAGCTCCCTCAGAGG - Intergenic
904553291 1:31339596-31339618 GCATTGGAGTGCTCCATCAATGG + Intronic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
907933705 1:59023009-59023031 GCATAAGAGGGGTCATTCAATGG + Intergenic
909888900 1:80978125-80978147 TCATCAGAGGAATCCCTCTAAGG + Intergenic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
913503669 1:119496029-119496051 GAATTGGAAGGCTCCCTCAAGGG - Intergenic
913510688 1:119558944-119558966 GCATCAGAGGGTCCCCATAAGGG - Intergenic
913514906 1:119596360-119596382 GCATCAGAAGGCCCCCATAAGGG - Intergenic
917220932 1:172727813-172727835 GCAACACAGGGCACTCTCAAGGG - Intergenic
921957994 1:221003831-221003853 GCAAAAGAGGGCACCCTAAAGGG - Intergenic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1068875096 10:61987198-61987220 GTATCATTGGGCTCCCTCATGGG - Intronic
1069609020 10:69759914-69759936 GCACCAGAGGGGTCTCCCAAGGG + Intergenic
1073096237 10:100981686-100981708 GCTTCAGAGAGGTCCCTCATGGG - Intronic
1078665352 11:13320369-13320391 GAAGCTGAGGGCACCCTCAAAGG - Intronic
1083700991 11:64477590-64477612 GCCTCAAAGGGCTCCCTCGATGG + Intergenic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1089861388 11:121593117-121593139 GCATCAGAGGGCTCCAATACTGG - Intronic
1090400928 11:126447720-126447742 GCCTCAGAGTGCTCCTTCCAGGG + Intronic
1090990939 11:131816199-131816221 GCCTCAGAGGTTTCCCTCCATGG - Intronic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1094847946 12:34369598-34369620 ACAGCAGAGGTCTCCCCCAACGG - Intergenic
1094855235 12:34399949-34399971 GCATCAGAGGTCCCCTGCAACGG + Intergenic
1102448986 12:113026454-113026476 GCAGAAGAGGGCTACCTCACAGG + Intergenic
1102816175 12:115868264-115868286 GCAGAAGAGGGCTACCTCACAGG - Intergenic
1103535776 12:121633038-121633060 GCATGGGAGGGCTGCCTCAGAGG + Intronic
1105013142 12:132769248-132769270 ACATCAGAGGGCTCCTCGAAGGG + Exonic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107154007 13:37145532-37145554 GAATCAGAGGCCTCCCACATTGG + Intergenic
1114450157 14:22820034-22820056 GCATCAGAGGTCACTGTCAATGG - Intronic
1115444127 14:33469946-33469968 GCATCAGGGGGCCAGCTCAAGGG + Intronic
1116748625 14:48852895-48852917 GCTTCAGAGGGCTCCTTCTCTGG + Intergenic
1119045080 14:71311541-71311563 GGTTCAAAGGGCTCCCTAAAAGG + Intergenic
1121052417 14:90828216-90828238 TCATCAGGAGGCTCCCTCATTGG - Intergenic
1121407139 14:93725976-93725998 GCCACAGAGGGCTCCCTAGATGG + Intronic
1122048644 14:99040731-99040753 CCATCAGAGGGCACCCACGAAGG - Intergenic
1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG + Intronic
1126801556 15:52302789-52302811 GCATCAGAGGCTTCCCACTATGG - Intergenic
1128458347 15:67846184-67846206 GCTTCAGTGGGCTCGCTCCATGG + Intergenic
1129830502 15:78666723-78666745 CCATAAGGGGGCTTCCTCAAGGG + Intronic
1132358737 15:101193922-101193944 GCAACAGAGGGCACCAGCAAGGG + Intronic
1136656902 16:31714730-31714752 GTAACAAAGGGCTCCCTCCATGG - Intronic
1138499226 16:57428680-57428702 GCACCAGAGGACTCACTCACTGG - Exonic
1146488101 17:33260425-33260447 GCTTCCTAGGGCTCCCCCAAAGG + Intronic
1148103806 17:45108670-45108692 CCATCAGAAGGCTGCCTCACAGG - Exonic
1153341305 18:3977836-3977858 GCATCAGAGGGGACCCTTGAGGG - Intronic
1155094671 18:22544340-22544362 GCATCATAGTGCTCCCCTAAAGG + Intergenic
1155513528 18:26600812-26600834 GCACCAGAGGACTCACTCACTGG + Intronic
1156089014 18:33442400-33442422 GCATCAGAGGGATTTATCAAAGG + Intergenic
1158293889 18:55972535-55972557 GATTCTGAGGGCTCCTTCAAGGG - Intergenic
1164251651 19:23482691-23482713 GCACCACAGGGATCCATCAAGGG + Intergenic
1164945332 19:32288486-32288508 CAATGAGAGGGCTCCCTCCAGGG - Intergenic
1166792873 19:45408340-45408362 GCTGCAGAGGGCTCCCTGACAGG - Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
1167202481 19:48075652-48075674 GCCTCAGAGAGCTCACTCCAAGG - Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
927967488 2:27280437-27280459 GCAGCAGAAGGCACCCTCACTGG - Exonic
929562166 2:42962679-42962701 GCGTCTGAGCCCTCCCTCAATGG - Intergenic
937702508 2:124879911-124879933 GCTTCAGAGGGGTCCCTATAAGG - Intronic
938473718 2:131589403-131589425 GCATCCCAGGGCACCCTCAGTGG - Intergenic
939517187 2:143183466-143183488 GCATCAGTGGGCACCATCAGAGG + Intronic
941080230 2:161052070-161052092 GCATCACTGGGCTACTTCAAAGG - Intergenic
942865959 2:180675287-180675309 GCTTCAGTGAGCTCCCTCATGGG - Intergenic
948787646 2:240361139-240361161 GCATCTGAAGGCGCCCTCCACGG + Intergenic
1168889338 20:1284117-1284139 GCACCAGAGGGTCCCCTCTAAGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170410351 20:16082424-16082446 GTGTCAGAGGGCTGCCTCACTGG - Intergenic
1175330996 20:58163785-58163807 GCCTCAGAGGCCTTCCTCACTGG - Intergenic
1175545203 20:59773466-59773488 GCAGCACAGGTCTCCCTCATGGG - Intronic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1179908334 21:44435489-44435511 CCATTAGAGGGCACCCTCCACGG + Intronic
1183356779 22:37363989-37364011 GCATCTGAGGACTCCCACATGGG - Intergenic
950558321 3:13708125-13708147 TCTCCACAGGGCTCCCTCAATGG - Intergenic
951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG + Intronic
953856772 3:46505350-46505372 GCATCCTAGTGCTCCCTCTAGGG + Intergenic
955126518 3:56117583-56117605 GGATAAGAGGACTCCCTCAAGGG + Intronic
960275246 3:115721645-115721667 GCAACAGATGTCTCCCTCGAGGG - Intergenic
960913865 3:122678336-122678358 CCATCAGGGGGCTCCCTCTGAGG + Intergenic
962264260 3:133934405-133934427 GCCTCAGTGGGCATCCTCAATGG + Exonic
964521193 3:157570141-157570163 GCAAAAGAGAGCTGCCTCAAAGG + Intronic
969219377 4:5749679-5749701 GCATCAGAGGGCTCGTTCCCTGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
971965568 4:33551011-33551033 GCATCAGAGAGCTCAATCAGAGG + Intergenic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977291384 4:95168565-95168587 GCACCAGAAGGGTCCCTCCAAGG + Exonic
981119778 4:141036634-141036656 GCATCAGTGGGCTGCATGAAGGG + Intronic
984490666 4:180430993-180431015 GTATCCGAGGCCTCCCTAAAAGG - Intergenic
985702310 5:1380926-1380948 GAAGCAGAGGGCTGCCTCATGGG + Intergenic
986298583 5:6460203-6460225 GCATCAGATGCCTCCCCTAAAGG + Intronic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
990575407 5:57119100-57119122 GGTTCAGAGAGCTCCCTCAATGG + Intergenic
997530432 5:134578422-134578444 GCGTCAGTGGGCTTCCTGAAAGG + Intronic
998393992 5:141806524-141806546 GCTACAGAGGACTCCCTCCAGGG - Intergenic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1006176275 6:32123833-32123855 GCATCAGCGGGCTCCCTGGTTGG + Intronic
1007063723 6:38968323-38968345 GCTTCAGAGGGCACCATCAGAGG + Intronic
1007094112 6:39202854-39202876 GAATCAGAGGGGTCTCTCGATGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1017911674 6:158798574-158798596 GCTTCAGAGACCTCCCTCGATGG + Intronic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1028572238 7:92303406-92303428 GAATCACAGGTTTCCCTCAAAGG - Intronic
1029906998 7:104102332-104102354 GCATCAGTTGGGTCCCTCACTGG + Intergenic
1030893065 7:115024464-115024486 GAAACAGATGGCTCCCTCATAGG - Intergenic
1036474030 8:9076864-9076886 GCCCCAGAGAGCTCCTTCAAAGG - Intronic
1043458917 8:80439783-80439805 GGATGAGAGGGCACCCTGAAGGG - Intergenic
1056214034 9:84391678-84391700 TCCTCATAGGGCTCCCCCAAAGG - Intergenic
1060103001 9:120856679-120856701 GCATCATTTGGTTCCCTCAAAGG - Exonic
1060515779 9:124264864-124264886 GCATCAGAGCTTTCCCTGAAAGG + Intronic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1062351958 9:136143706-136143728 GCAATAAAGGGCTCCCTCCAGGG - Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1193695959 X:84707955-84707977 GCAACAGAGTGCTGCCTCACAGG + Intergenic
1195467156 X:105192061-105192083 GCACCAGTTGGCTCCCTCTATGG + Intronic
1197511373 X:127372707-127372729 GCATCAGAGAGCTTCTTCAGAGG + Intergenic