ID: 1020552293

View in Genome Browser
Species Human (GRCh38)
Location 7:9621730-9621752
Sequence GACAGGCCCCGCACTCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020552293_1020552296 -5 Left 1020552293 7:9621730-9621752 CCGCTCCGAGTGCGGGGCCTGTC No data
Right 1020552296 7:9621748-9621770 CTGTCGAACCCACGCCCACCCGG No data
1020552293_1020552299 7 Left 1020552293 7:9621730-9621752 CCGCTCCGAGTGCGGGGCCTGTC No data
Right 1020552299 7:9621760-9621782 CGCCCACCCGGAACTCACGCTGG 0: 35
1: 186
2: 822
3: 705
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020552293 Original CRISPR GACAGGCCCCGCACTCGGAG CGG (reversed) Intergenic
No off target data available for this crispr