ID: 1020555460

View in Genome Browser
Species Human (GRCh38)
Location 7:9664442-9664464
Sequence TATTTTTGCAAAGCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020555457_1020555460 23 Left 1020555457 7:9664396-9664418 CCTATCAGTGAAGAGAGGTCAGA No data
Right 1020555460 7:9664442-9664464 TATTTTTGCAAAGCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020555460 Original CRISPR TATTTTTGCAAAGCTGTTCC AGG Intergenic
No off target data available for this crispr