ID: 1020560450

View in Genome Browser
Species Human (GRCh38)
Location 7:9724910-9724932
Sequence TTAGTTTTCCACATCCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020560450_1020560452 9 Left 1020560450 7:9724910-9724932 CCAAAATGGATGTGGAAAACTAA No data
Right 1020560452 7:9724942-9724964 GATGAAATGGAAAAGCAAAATGG No data
1020560450_1020560453 29 Left 1020560450 7:9724910-9724932 CCAAAATGGATGTGGAAAACTAA No data
Right 1020560453 7:9724962-9724984 TGGATACCTGAAAATTTTGCAGG No data
1020560450_1020560451 -4 Left 1020560450 7:9724910-9724932 CCAAAATGGATGTGGAAAACTAA No data
Right 1020560451 7:9724929-9724951 CTAATTATGTTTAGATGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020560450 Original CRISPR TTAGTTTTCCACATCCATTT TGG (reversed) Intergenic
No off target data available for this crispr