ID: 1020561571

View in Genome Browser
Species Human (GRCh38)
Location 7:9734172-9734194
Sequence GTATATATTAAGTTTAGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020561571_1020561574 22 Left 1020561571 7:9734172-9734194 CCCAATCTAAACTTAATATATAC No data
Right 1020561574 7:9734217-9734239 TATAACTTAGAACCTTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020561571 Original CRISPR GTATATATTAAGTTTAGATT GGG (reversed) Intergenic
No off target data available for this crispr