ID: 1020564165

View in Genome Browser
Species Human (GRCh38)
Location 7:9774951-9774973
Sequence TTAGCGACTGTGTGGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020564158_1020564165 -2 Left 1020564158 7:9774930-9774952 CCACAAGTTTCCAATTGCCTCTT No data
Right 1020564165 7:9774951-9774973 TTAGCGACTGTGTGGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020564165 Original CRISPR TTAGCGACTGTGTGGTGGGT GGG Intergenic
No off target data available for this crispr