ID: 1020564856

View in Genome Browser
Species Human (GRCh38)
Location 7:9782319-9782341
Sequence ACTGGAGGATGTTACTATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020564856_1020564862 22 Left 1020564856 7:9782319-9782341 CCACTATAGTAACATCCTCCAGT No data
Right 1020564862 7:9782364-9782386 GATTCCCTGTCTAAATCTGAAGG No data
1020564856_1020564861 0 Left 1020564856 7:9782319-9782341 CCACTATAGTAACATCCTCCAGT No data
Right 1020564861 7:9782342-9782364 CATACTGGGATCAATAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020564856 Original CRISPR ACTGGAGGATGTTACTATAG TGG (reversed) Intergenic
No off target data available for this crispr