ID: 1020564861

View in Genome Browser
Species Human (GRCh38)
Location 7:9782342-9782364
Sequence CATACTGGGATCAATAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020564856_1020564861 0 Left 1020564856 7:9782319-9782341 CCACTATAGTAACATCCTCCAGT No data
Right 1020564861 7:9782342-9782364 CATACTGGGATCAATAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020564861 Original CRISPR CATACTGGGATCAATAGAAT TGG Intergenic
No off target data available for this crispr