ID: 1020564862

View in Genome Browser
Species Human (GRCh38)
Location 7:9782364-9782386
Sequence GATTCCCTGTCTAAATCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020564860_1020564862 4 Left 1020564860 7:9782337-9782359 CCAGTCATACTGGGATCAATAGA No data
Right 1020564862 7:9782364-9782386 GATTCCCTGTCTAAATCTGAAGG No data
1020564856_1020564862 22 Left 1020564856 7:9782319-9782341 CCACTATAGTAACATCCTCCAGT No data
Right 1020564862 7:9782364-9782386 GATTCCCTGTCTAAATCTGAAGG No data
1020564859_1020564862 7 Left 1020564859 7:9782334-9782356 CCTCCAGTCATACTGGGATCAAT No data
Right 1020564862 7:9782364-9782386 GATTCCCTGTCTAAATCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020564862 Original CRISPR GATTCCCTGTCTAAATCTGA AGG Intergenic
No off target data available for this crispr