ID: 1020567545

View in Genome Browser
Species Human (GRCh38)
Location 7:9817197-9817219
Sequence CCTCTTACCTTTAAGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020567545_1020567549 -1 Left 1020567545 7:9817197-9817219 CCTGTTTTCTTAAAGGTAAGAGG No data
Right 1020567549 7:9817219-9817241 GAGCCCAAAGTGTCCAGGTAGGG No data
1020567545_1020567553 21 Left 1020567545 7:9817197-9817219 CCTGTTTTCTTAAAGGTAAGAGG No data
Right 1020567553 7:9817241-9817263 GATCTTAACTTCCAGTTTAATGG No data
1020567545_1020567548 -2 Left 1020567545 7:9817197-9817219 CCTGTTTTCTTAAAGGTAAGAGG No data
Right 1020567548 7:9817218-9817240 GGAGCCCAAAGTGTCCAGGTAGG No data
1020567545_1020567547 -6 Left 1020567545 7:9817197-9817219 CCTGTTTTCTTAAAGGTAAGAGG No data
Right 1020567547 7:9817214-9817236 AAGAGGAGCCCAAAGTGTCCAGG 0: 11
1: 132
2: 245
3: 198
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020567545 Original CRISPR CCTCTTACCTTTAAGAAAAC AGG (reversed) Intergenic
No off target data available for this crispr