ID: 1020567547

View in Genome Browser
Species Human (GRCh38)
Location 7:9817214-9817236
Sequence AAGAGGAGCCCAAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 934
Summary {0: 11, 1: 132, 2: 245, 3: 198, 4: 348}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020567539_1020567547 23 Left 1020567539 7:9817168-9817190 CCCAGCCAACGCTGTAACTCCCT No data
Right 1020567547 7:9817214-9817236 AAGAGGAGCCCAAAGTGTCCAGG 0: 11
1: 132
2: 245
3: 198
4: 348
1020567542_1020567547 4 Left 1020567542 7:9817187-9817209 CCCTTATTAGCCTGTTTTCTTAA No data
Right 1020567547 7:9817214-9817236 AAGAGGAGCCCAAAGTGTCCAGG 0: 11
1: 132
2: 245
3: 198
4: 348
1020567538_1020567547 24 Left 1020567538 7:9817167-9817189 CCCCAGCCAACGCTGTAACTCCC No data
Right 1020567547 7:9817214-9817236 AAGAGGAGCCCAAAGTGTCCAGG 0: 11
1: 132
2: 245
3: 198
4: 348
1020567543_1020567547 3 Left 1020567543 7:9817188-9817210 CCTTATTAGCCTGTTTTCTTAAA No data
Right 1020567547 7:9817214-9817236 AAGAGGAGCCCAAAGTGTCCAGG 0: 11
1: 132
2: 245
3: 198
4: 348
1020567540_1020567547 22 Left 1020567540 7:9817169-9817191 CCAGCCAACGCTGTAACTCCCTT No data
Right 1020567547 7:9817214-9817236 AAGAGGAGCCCAAAGTGTCCAGG 0: 11
1: 132
2: 245
3: 198
4: 348
1020567541_1020567547 18 Left 1020567541 7:9817173-9817195 CCAACGCTGTAACTCCCTTATTA No data
Right 1020567547 7:9817214-9817236 AAGAGGAGCCCAAAGTGTCCAGG 0: 11
1: 132
2: 245
3: 198
4: 348
1020567545_1020567547 -6 Left 1020567545 7:9817197-9817219 CCTGTTTTCTTAAAGGTAAGAGG No data
Right 1020567547 7:9817214-9817236 AAGAGGAGCCCAAAGTGTCCAGG 0: 11
1: 132
2: 245
3: 198
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020567547 Original CRISPR AAGAGGAGCCCAAAGTGTCC AGG Intergenic
900756683 1:4440281-4440303 AGGAGGAGCACAGAGTGTGCAGG - Intergenic
901637118 1:10675650-10675672 GAGAGGAGCCCAGAGTGGCTGGG - Intronic
901903691 1:12390017-12390039 AGGCGGAGCCCAAAGTGTCCAGG + Intronic
904460980 1:30679701-30679723 CAGAGGGGGCCAAAGTGTCAGGG - Intergenic
904926295 1:34050989-34051011 ATGAGGAGTGCAAAGTGCCCGGG - Intronic
905109925 1:35587851-35587873 ATGTGGAGCCCACAGTCTCCAGG + Intronic
905354307 1:37370453-37370475 AGGAGGAGCCCGAAGTGTCCAGG - Intergenic
905465466 1:38149775-38149797 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
905800976 1:40842428-40842450 ATGAGGAGCCCACAATGGCCTGG + Intergenic
906050716 1:42869078-42869100 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
906725833 1:48043534-48043556 CAGAGGAGCCCCAGGTGTGCAGG + Intergenic
906879887 1:49578124-49578146 AGGAGGAGACTAAAGTATCCAGG - Intronic
906930690 1:50166855-50166877 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
907512329 1:54970844-54970866 AAGCAGAGCCCAATGTGTGCAGG + Intergenic
907597579 1:55733787-55733809 AGGAGAAGCCCAAAGTATCCTGG - Intergenic
907601917 1:55780619-55780641 AGGAGGAGTCCAAAGTGGCCAGG + Intergenic
908046720 1:60178410-60178432 ACGAGGAGCCCAGAGTGGCTGGG + Intergenic
908052549 1:60248370-60248392 AGGAAGAGCCCAAATTGTCCAGG - Intergenic
908596588 1:65694696-65694718 ATGAGGAGCCCCAAGTGGCCAGG - Intergenic
908617997 1:65944900-65944922 ATAAGGAGCCCAAAGTGACCAGG - Intronic
908737629 1:67292474-67292496 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
909032651 1:70560625-70560647 AGGAGGAGCCCAAAGTGGCCAGG + Intergenic
909172379 1:72313799-72313821 AGGAGGAGCCCTAAATGTCCAGG + Intergenic
909255004 1:73408675-73408697 AAGATGAGCCCAAAGCTTCTTGG + Intergenic
909548719 1:76875515-76875537 AGGAGGAACCCAAGGTGTCCAGG + Intronic
909577156 1:77187502-77187524 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
909811169 1:79932999-79933021 AGGAGGACCCCAAAGTGTACAGG - Intergenic
909858690 1:80575371-80575393 AGAAGGAGCCCAAAGTGGCCAGG + Intergenic
910010363 1:82453675-82453697 ATGAGGAGCCCAAAGGGGCTGGG - Intergenic
910141738 1:84033712-84033734 ATGAGGAGTCCAAAATATCCAGG - Intergenic
910253195 1:85219803-85219825 ATGAGGAGCCCAAAATTACCAGG - Intergenic
910370872 1:86513817-86513839 AGGAGAAGCCCAAAGTGTCCAGG - Intergenic
910588451 1:88903391-88903413 AGCAGGAGCCCAAAGTGTCCAGG - Intergenic
910630444 1:89347933-89347955 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
910790522 1:91045106-91045128 AGGAGGAGCCCAGAGTGTCCAGG - Intergenic
910791583 1:91056474-91056496 AGGAGGAGCCCAAAGTTGCCAGG + Intergenic
910830863 1:91461752-91461774 AGGAGGATCCCAAAGTGTCCAGG + Intergenic
910948445 1:92618378-92618400 AGGAACAGCCCGAAGTGTCCAGG - Intronic
911257108 1:95645692-95645714 AGGAGGAGCCCAAAGGGCCCAGG + Intergenic
911496887 1:98642924-98642946 ATGAGGAGCCCCAAGTGGCTGGG - Intergenic
911738176 1:101360265-101360287 AGGAGGGTCCCAAAGTGTCCAGG + Intergenic
911831742 1:102557959-102557981 AGGGGGAGCCCAAAGTGTCCAGG + Intergenic
911883797 1:103272133-103272155 AGGAGGAGCCTAAAGTGTCCAGG - Intergenic
911980638 1:104561084-104561106 AGGAGGAGCCCAAAGTGCTCAGG - Intergenic
912045175 1:105444794-105444816 ACGAGGGGTCCAAAGTGACCGGG - Intergenic
912050475 1:105523272-105523294 GGGAGGAGCCCAAAGTGTCCAGG + Intergenic
912067233 1:105758622-105758644 AAGGGGAGCACAAAGTGTCCAGG - Intergenic
912103443 1:106240648-106240670 AAGAGGAAGTCAAATTGTCCCGG + Intergenic
912129689 1:106586389-106586411 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
912251804 1:108019811-108019833 AGGAGGACCCCAAAGTGTCCGGG + Intergenic
912733089 1:112127166-112127188 GGGAGGAGCCCAAAGTCTTCAGG + Intergenic
912943521 1:114066224-114066246 AGGAGGAGTCCAAAGTGTTCAGG + Intergenic
913039220 1:115006724-115006746 AGGAAGAGCCCAAAGTGTTTAGG + Intergenic
913081378 1:115390469-115390491 ACGAAAAGCCCAAAGTGGCCAGG - Intergenic
913559390 1:120002241-120002263 GGTAGGAACCCAAAGTGTCCTGG - Intronic
913638471 1:120788301-120788323 GGTAGGAACCCAAAGTGTCCTGG + Intergenic
914279985 1:146161684-146161706 GGTAGGAACCCAAAGTGTCCTGG - Intronic
914410986 1:147427275-147427297 AAGAGGAAGTCAAATTGTCCCGG + Intergenic
914459996 1:147874960-147874982 AAGAGGAAGTCAAATTGTCCCGG - Intergenic
914541025 1:148612602-148612624 GGTAGGAACCCAAAGTGTCCTGG - Intronic
914625617 1:149458644-149458666 GGTAGGAACCCAAAGTGTCCTGG + Intergenic
915057012 1:153142410-153142432 AAGAGGAAGTCAAATTGTCCCGG - Intergenic
915667442 1:157458026-157458048 AAGAGGAGCCTAAAGTGTCCAGG + Intergenic
915709882 1:157885308-157885330 AGGAGAAGCCCCAAATGTCCAGG - Intronic
916105959 1:161432628-161432650 AGGAGGAGCCCAAAGTGTCTAGG + Intergenic
916285556 1:163101182-163101204 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
917216988 1:172689237-172689259 AGGAGGAGCCTAAAGTGTCCAGG + Intergenic
917247797 1:173023550-173023572 ATGAGGAAACCAAAGTGACCAGG + Intergenic
917283424 1:173400570-173400592 ATGAAGAGCCCAAAGTGGCCAGG - Intergenic
917764764 1:178203678-178203700 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
918304675 1:183235123-183235145 AGGAGGAACCAAAAGTATCCAGG + Intronic
918755489 1:188336149-188336171 AGGAGGAGACCAAACTGTCCAGG + Intergenic
918768686 1:188523522-188523544 AGGAGGATCCAAAAGTGTCCAGG - Intergenic
918783239 1:188730881-188730903 AGGAGGAGCCCAAAGTGGCCAGG + Intergenic
918815272 1:189172863-189172885 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
918918012 1:190670215-190670237 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
919167219 1:193910732-193910754 AAGATGAGAGCAAAGTGCCCTGG + Intergenic
919230006 1:194762327-194762349 AGGAGGAGTCCAAAGTGTCCAGG + Intergenic
919241990 1:194925868-194925890 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
919318197 1:196001015-196001037 AGGAGGATCCCAAAGTGACTAGG - Intergenic
919330431 1:196163535-196163557 AGTAGGAGCCTAAAGTGTCCAGG - Intergenic
919478860 1:198062026-198062048 ATGAGGAACCCAAAGTGGCCAGG + Intergenic
919501815 1:198346850-198346872 ATAAGGAGCCCAAAATGTCCAGG - Intergenic
920197666 1:204240025-204240047 ACGAGGAATCTAAAGTGTCCAGG - Intronic
920583480 1:207135433-207135455 ATTAGGAGCCCAAAGTGATCAGG + Intronic
921450709 1:215302503-215302525 ATGAGGAGCCCAAAATGGCCAGG - Intergenic
922331580 1:224581555-224581577 AAGAAGAGCCCAAAGCGTGTTGG + Intronic
922780824 1:228250937-228250959 AGGAGGAGCCCAAAGTGGCCAGG + Intronic
922956331 1:229604436-229604458 GTGAGGAGCCCAAAGTGGCTGGG - Intronic
923253351 1:232197779-232197801 AGGAGGAGTCCAAAGTGTCCAGG + Intergenic
923957470 1:239039325-239039347 AGGAGGAGCCCAAAGTGGCCAGG - Intergenic
924184815 1:241476864-241476886 AAGAGAAGCCCAGAGCTTCCTGG - Intergenic
924492163 1:244548962-244548984 ATGAGGAGCCCAAAGTGGTGAGG - Intronic
924846907 1:247783477-247783499 AGGAGGAGAACAAAGTGTCCAGG + Intergenic
1063788356 10:9410177-9410199 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1064445805 10:15391816-15391838 ATGAGAAACCCAAAGTGACCTGG + Intergenic
1064517355 10:16166114-16166136 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1064925647 10:20565810-20565832 AAGTGGGGCCCAAAGCCTCCCGG - Intergenic
1065460641 10:25959640-25959662 AAGAGGAGGCCAAGGGATCCAGG - Intronic
1065661377 10:28007214-28007236 ATGAGGAGCCCAATGTAGCCAGG - Intergenic
1066393802 10:34999791-34999813 ATGAGGAGCTCAAAGTGGCTGGG - Intergenic
1066449084 10:35511732-35511754 AAGATGAACCCACAGTGTTCTGG - Intronic
1066629992 10:37449868-37449890 AGGAGGAGCCCGAAGTGACCAGG - Intergenic
1067125322 10:43510881-43510903 AGAAGAAGCCCAAAGTGTTCAGG + Intergenic
1067177954 10:43963394-43963416 CACAGAGGCCCAAAGTGTCCAGG + Intergenic
1067516658 10:46952899-46952921 ATGAGGAACCCAAAATGTCCTGG + Intronic
1067645592 10:48098894-48098916 ATGAGGAACCCAAAATGTCCTGG - Intergenic
1067754128 10:48992047-48992069 TGAAGGAGCCCAAAGTGTCCAGG + Intergenic
1068447426 10:57140255-57140277 AGGAGGAGCCCAAAGTATCCAGG - Intergenic
1068836989 10:61566710-61566732 AGGAGCAGCCCAAAGTGTCCAGG + Intergenic
1068856857 10:61806550-61806572 ACAAGGAACCCAAAGTGGCCGGG - Intergenic
1068908749 10:62356205-62356227 ATCAGGAGCCCAAAGTGGCTGGG + Intergenic
1069139139 10:64802210-64802232 ATGAGGAGCCCAAAGTGGCCAGG + Intergenic
1069145978 10:64892090-64892112 AGGAGAAGCCCAAAGTGACCAGG - Intergenic
1069695482 10:70382524-70382546 AAGTGGAGCCAAAAGCGGCCCGG - Intronic
1069755336 10:70771323-70771345 AAGAGCAGCCCCAAGGGTTCAGG - Exonic
1069790593 10:71017913-71017935 AGGAGGATCCCAAACTGTCCAGG + Intergenic
1069837193 10:71316926-71316948 AAGACAAGCCCACATTGTCCGGG + Intergenic
1070199376 10:74188645-74188667 AAGAGGAGAGCAAGGTGGCCGGG - Intronic
1071032974 10:81206439-81206461 AGGAGAATCCCAAAGTGGCCAGG - Intergenic
1071266846 10:83972334-83972356 AGCAGGAGCCCAAAGTTTCCAGG + Intergenic
1071308738 10:84323748-84323770 AGGTGGAGCCTAAAGTGGCCAGG - Intergenic
1071364247 10:84882853-84882875 AGGAGGAGCCCAAAGTGGCCAGG + Intergenic
1071378612 10:85035028-85035050 AGAAAGAGCCCAAAGTGGCCAGG - Intergenic
1071673700 10:87635758-87635780 AGGAGGAGCCCAAAGTGGCAAGG + Intergenic
1071760076 10:88593177-88593199 ATGAAGAGCCCAAAGTGACCAGG + Intronic
1071937909 10:90550931-90550953 AGGAGGAGCCCAGAGTGTCCAGG - Intergenic
1071942551 10:90606113-90606135 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1072209029 10:93230042-93230064 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1072744440 10:97929952-97929974 AAGAGGAGCCCAGGCTGTGCTGG + Intronic
1073015140 10:100392882-100392904 AAGAGGAACACAAAGGATCCAGG - Intergenic
1073346492 10:102786794-102786816 AAGATGAGCCCACAGTGTCATGG - Intronic
1073557589 10:104467562-104467584 AGGAGAAGCCAAAAGTGTCCAGG - Intergenic
1073830315 10:107376357-107376379 ATGAGGAACCCAAAGTGGCCAGG + Intergenic
1073918264 10:108430782-108430804 AGGAGGAGCCCCAAGTGTCCAGG + Intergenic
1073995651 10:109313119-109313141 AGGAGAAGACCAAAGTGTCCAGG + Intergenic
1074154862 10:110789210-110789232 AAGAGAAGACCAAAGTGACACGG + Intronic
1074235451 10:111580448-111580470 ATGAGGAACCCAAAGTGGCCAGG + Intergenic
1074243974 10:111669335-111669357 AGGAGGATCCTGAAGTGTCCAGG + Intergenic
1074822828 10:117194303-117194325 ACGAGGATCCCAAAGTGCCCAGG - Intergenic
1075607027 10:123819073-123819095 AGGAGGAGCCCAAAGCATCTAGG - Intronic
1075855060 10:125622847-125622869 AGGAGGAGCCCAGAGTGGCCAGG + Intronic
1076271536 10:129156475-129156497 ATGAGGAGCCCAAAGTGTCCAGG - Intergenic
1076395358 10:130134898-130134920 AGAAGGAGCCCCAAGTGTCTGGG + Intergenic
1076480179 10:130779764-130779786 CAGGAGAGCACAAAGTGTCCAGG + Intergenic
1076772379 10:132673168-132673190 AGGAGGAGCCCAGAGTATCCAGG + Intronic
1076927034 10:133496542-133496564 AGGAGGAGCCCGAAGTGTCCAGG + Intergenic
1077342415 11:2031999-2032021 AAGACGACCCCAAAGTGTGCCGG - Intergenic
1077382064 11:2248728-2248750 ACCAGGAGCCCGAAGTGACCAGG - Intergenic
1078906369 11:15691847-15691869 AGGAGGAGCCCAAAGTGACCTGG - Intergenic
1080042029 11:27769157-27769179 AGGAGGAGTCCAAAGTGTCCAGG + Intergenic
1080076827 11:28159159-28159181 AGGAGGAACCCAAAGTGTCCAGG - Intronic
1081110756 11:39130385-39130407 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1081609297 11:44549531-44549553 ACGAGGAGCCCAAAGTGTCCAGG - Intergenic
1082671914 11:56044672-56044694 AGGAGGGTCCCAAAGTGTCCAGG - Intergenic
1082715445 11:56606476-56606498 AGGAAGAGCTCAAAGTGGCCAGG - Intergenic
1082836049 11:57650741-57650763 AAGAAGAGCCCAAAGTGGCCAGG - Intronic
1082999878 11:59281507-59281529 AGGAGGAGCTCAAAGTGTCCAGG - Intergenic
1083093359 11:60222765-60222787 AAGAGGAGCCCAAAATGGCCAGG - Intronic
1083789485 11:64975249-64975271 ATAAGAAGCCCAAAGTGGCCGGG - Intergenic
1085686193 11:78623832-78623854 AAGAGGAGCCCAAAGTGTCCAGG - Intergenic
1085937906 11:81172047-81172069 AGGAGGAGCCCAAAGTGTCTAGG + Intergenic
1086141401 11:83504532-83504554 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1086278833 11:85162083-85162105 GGGAGGAGCCCAAAGTGTCCAGG - Intronic
1086425332 11:86677214-86677236 AACACGAGCCCTTAGTGTCCTGG - Intergenic
1086834348 11:91602037-91602059 AGGGGGAGACCAAAGTGTCCAGG - Intergenic
1087374241 11:97322190-97322212 AGGAGGAACCCAAAGTGCCGAGG - Intergenic
1088097427 11:106116804-106116826 AGAAGGAGCCCAAAGTGGCCAGG - Intergenic
1088157767 11:106829627-106829649 AGGAGGAGCTCAAAATATCCAGG - Intronic
1088191446 11:107233043-107233065 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1088265660 11:107985247-107985269 AGGAGAAGCCCAAAGTGTCCAGG - Intergenic
1088388489 11:109287612-109287634 AGGAAGAGCCCAAAGTGTCCAGG - Intergenic
1088407386 11:109497026-109497048 AGGGGGAGCCCAAAATGTCTGGG + Intergenic
1088449574 11:109966994-109967016 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1088836886 11:113585024-113585046 AGGAGAAGCCCAAAGTGTCCAGG - Intergenic
1089142208 11:116294599-116294621 ATGAGAAGCCCAAAGTGGCTGGG - Intergenic
1089806304 11:121093875-121093897 ACAAGGAGCCCAGTGTGTCCAGG + Intergenic
1089903850 11:122015256-122015278 AGGAGGAGCCCAGAGTGTCCAGG - Intergenic
1090197039 11:124825680-124825702 AAGAGAAGCCCAAAGTGGCCAGG + Intergenic
1090209257 11:124906412-124906434 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
1090221389 11:125029991-125030013 AGGAGGAGCCCAAATTGTCCAGG + Intronic
1090753795 11:129770949-129770971 ATAAGGACCCCAAAGTGGCCAGG + Intergenic
1091051970 11:132380383-132380405 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1091311360 11:134577359-134577381 AAGTGCAGGCCAAGGTGTCCTGG + Intergenic
1202825401 11_KI270721v1_random:87188-87210 AAGACGACCCCAAAGTGTGCCGG - Intergenic
1092093854 12:5825595-5825617 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1092381851 12:8003046-8003068 GGAAGGAGTCCAAAGTGTCCAGG - Intergenic
1093031583 12:14293972-14293994 AGGAGGAGCTCAAAGTGTCCAGG + Intergenic
1093036575 12:14337326-14337348 AGGAGGAGCCTAAAGTGTCCAGG - Intergenic
1093048696 12:14483440-14483462 AAGAGGAGCCCAAAGTGTCCAGG + Intronic
1093049443 12:14489340-14489362 AGGAGGATCCCAAAGTATCCAGG + Intronic
1093645944 12:21585297-21585319 GGGAGGAGCCCAAAGTGTCCAGG - Intronic
1093753038 12:22822198-22822220 ATGAGAATCCCAAAGTGGCCCGG - Intergenic
1093964766 12:25312571-25312593 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1093981388 12:25479151-25479173 AGGAGGAGCCCAAAGTGTACAGG + Intronic
1094045225 12:26159427-26159449 CAGGAGAGCCCATAGTGTCCTGG + Intronic
1094102759 12:26780906-26780928 AGGAGGAACCCAAAGTGTCCAGG - Intronic
1094240276 12:28214179-28214201 ATGAGGAGTCCAAAGTGACCAGG - Intronic
1094325149 12:29230230-29230252 AACAGGAGTCCAGAGTGTGCAGG + Intronic
1094389559 12:29934576-29934598 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1095190454 12:39251775-39251797 ATGAGGGGCCCAAAGAGGCCAGG - Intergenic
1095604124 12:44046285-44046307 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1095844162 12:46728329-46728351 AGGAGGAGCCCAAAGTGTTCAGG + Intergenic
1095856026 12:46862045-46862067 CGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1095947573 12:47762308-47762330 AAGGTGAGCCCATAGTTTCCTGG + Intronic
1096090724 12:48898845-48898867 CTGAGGATCCCAAAGTGGCCAGG - Intergenic
1096289000 12:50324896-50324918 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1096892270 12:54783796-54783818 AAGAGAAGCCAAAAGTGTGCAGG - Intergenic
1097040781 12:56154702-56154724 AGGAGGGGCCCAAAGGGACCAGG - Intronic
1097437596 12:59570619-59570641 AGGAGAAGCCCAAAGTATCCAGG + Intergenic
1097518496 12:60637682-60637704 AGGAGGAGTCCAAAGTGTCCGGG - Intergenic
1097554808 12:61123248-61123270 AGGAGGAACCTAAAGTGGCCAGG - Intergenic
1097821115 12:64130272-64130294 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1097843110 12:64341108-64341130 AGGAGGAGCCCAATGTGTCCAGG + Intronic
1098673247 12:73255891-73255913 AAGAGGAGCCCAAAGTGTCCAGG - Intergenic
1098745935 12:74236645-74236667 ATGAGAAGCCCAAAGTGGCTGGG - Intergenic
1098750053 12:74281238-74281260 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1098831693 12:75372388-75372410 AGGAGGAGCCCAGAGTAACCAGG + Intronic
1099183164 12:79490957-79490979 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1099366148 12:81767027-81767049 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1099379163 12:81934902-81934924 AGGAAGAGCCCAAAGTGTCCAGG + Intergenic
1099401026 12:82204118-82204140 AGGAGGAGTCCAAAGTGGCCAGG + Intergenic
1099490454 12:83282609-83282631 AAGAGGAGACCAAAGTGTCCAGG + Intergenic
1099578279 12:84407042-84407064 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
1099632527 12:85168430-85168452 AGGAGGAGCACAAAGTAGCCAGG + Intronic
1099700658 12:86077915-86077937 AGAAGGAGCCCAAAATGTCCAGG + Intronic
1099736054 12:86567367-86567389 GAGAGGAGCCCAAAGTGGCCAGG - Intronic
1100240912 12:92709960-92709982 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1101264369 12:103067777-103067799 AGGGAGAGCCCAAAGTGTCCAGG - Intergenic
1101534380 12:105604110-105604132 AGGAGGCACCCAAAGTGTCCTGG + Intergenic
1101543289 12:105684281-105684303 AGGATGAACCCAAAGTGTCTAGG - Intergenic
1102162423 12:110780548-110780570 AAGAGGAGAAAAAAGTTTCCGGG + Intergenic
1103035861 12:117655712-117655734 AGGAGGAGCTCAAAGTGTCCAGG - Intronic
1103396763 12:120613082-120613104 AGGAGGAGCCCAAAGTATCCAGG - Intergenic
1104198001 12:126559726-126559748 AAGAGGTGCCAAAAGTGGCAGGG + Intergenic
1105740348 13:23316822-23316844 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1105946296 13:25192657-25192679 AGGAGGAGCCCAGAGTGGCAGGG - Intergenic
1106770501 13:32956947-32956969 ATAAGGAGCCCAAAGTGCCTGGG + Intergenic
1107438965 13:40407094-40407116 AAGAGAAGCCCAAAGCGTGCCGG + Intergenic
1107983352 13:45754320-45754342 AGGAGGAGCCCAAAATGTCCAGG + Intergenic
1108904495 13:55451603-55451625 AGGAGGAGCACAAAGTGTCCAGG - Intergenic
1108914082 13:55587256-55587278 AGGAGAAGCACAAAGTGTCCAGG + Intergenic
1108934316 13:55866986-55867008 GAGAGGAGCCCCAAGAGCCCTGG + Intergenic
1109009433 13:56921676-56921698 ATAAGGAGCCCAAAGTGGCTAGG - Intergenic
1109069654 13:57748239-57748261 ATGAGGAGCCCAAAGTGGCCAGG - Intergenic
1109516110 13:63444054-63444076 AGGAGGAGCCCAAACTATCCAGG - Intergenic
1109583315 13:64368138-64368160 AGGAGGATCCCAAAGTGTCCAGG - Intergenic
1109712459 13:66179204-66179226 AGGAAGATCCCAAAGTGGCCAGG + Intergenic
1109762516 13:66848631-66848653 AAGAGGAGCCAAAATCGGCCGGG + Intronic
1109931830 13:69226056-69226078 GGGAGGAGCCCAAAGTGGCCAGG - Intergenic
1109950799 13:69500572-69500594 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1110377385 13:74808152-74808174 AGAAGGAGTCCAAAATGTCCAGG - Intergenic
1110377548 13:74809675-74809697 AGAAGGAGTCCAAAATGTCCAGG + Intergenic
1110833913 13:80062976-80062998 AGGAGGAGTCCAAAGTGTCCAGG + Intergenic
1110965136 13:81685327-81685349 AACATGAGCCCAAGGTGGCCAGG + Intergenic
1111057571 13:82971388-82971410 AGGAGGAGCCCAAAGGGTCCAGG + Intergenic
1111198754 13:84906531-84906553 AGGAGCAGCCCAAAGTGGCCAGG - Intergenic
1111208875 13:85050424-85050446 AGGTGGAGCGCAAAGTGTCCAGG + Intergenic
1111363394 13:87207360-87207382 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1111535422 13:89596812-89596834 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
1111536087 13:89604968-89604990 AGGAGGAGCACAAAGTAACCAGG + Intergenic
1111877542 13:93915897-93915919 CAGAGGAGCTAGAAGTGTCCTGG + Intronic
1112230892 13:97588524-97588546 AGGAGGAGCCCAAAGCATCCAGG + Intergenic
1112832610 13:103472055-103472077 AGGAGGAGCACAAAGTGGCCAGG + Intergenic
1112875869 13:104037551-104037573 AAGAGGAGCCCAAAGTGTCCAGG + Intergenic
1113396368 13:109951251-109951273 AGGTGGAGCCCAAAGTGTTCAGG - Intergenic
1113537703 13:111081505-111081527 ACGAGGAGGCCAAAGTGACCAGG + Intergenic
1114206091 14:20572413-20572435 AGGAGGAGCCCAAAGTGTCCGGG - Intergenic
1114241335 14:20871200-20871222 ACGAGAAATCCAAAGTGTCCTGG - Intergenic
1114758027 14:25282237-25282259 AGGGGGAACCCAAAGTGTCCAGG + Intergenic
1115130908 14:30050905-30050927 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1115139132 14:30148000-30148022 AACAGAAACCCAAAGTGTGCAGG + Intronic
1116059122 14:39898562-39898584 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
1116068314 14:40010804-40010826 AGAAGGAGCCCAAAATGACCAGG - Intergenic
1116249267 14:42459279-42459301 AGCAGGAGCCCAAAGTGGCCAGG - Intergenic
1116415298 14:44671008-44671030 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1116891786 14:50275971-50275993 CAGGGGAACCCAAAGTGGCCAGG - Intronic
1117217077 14:53561801-53561823 AGGAGAAGCCCAAAGTGTCCAGG - Intergenic
1117596047 14:57328233-57328255 AGGAGAAGCCCAAAGTGTCCAGG + Intergenic
1117856409 14:60038713-60038735 AAGAGGAAGTCAAATTGTCCCGG - Intronic
1118017625 14:61675999-61676021 AAATAGAGCCCAAAGTGACCAGG + Intergenic
1118122206 14:62858540-62858562 AGGAAGAGCCCAAAGTGTCCAGG + Intronic
1118385102 14:65249635-65249657 ATAAGGAGTCCAAAGTGGCCAGG + Intergenic
1118449869 14:65890578-65890600 AAGAGGGGCTCAAAGTGTGCAGG + Intergenic
1118460347 14:65981386-65981408 AAGCAGAGCCCGAAGTGCCCAGG + Intronic
1118950529 14:70432932-70432954 AGGAGGAGTCCAAAGTGTCCAGG + Intergenic
1119059473 14:71460549-71460571 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1119107319 14:71937199-71937221 AGGAGTATCCCAAACTGTCCAGG + Intronic
1120081794 14:80225888-80225910 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1120350576 14:83352586-83352608 AGGAGGACCCCAAAGTGTCCAGG - Intergenic
1120498184 14:85261951-85261973 AGGAAGAGCACGAAGTGTCCAGG + Intergenic
1120555793 14:85928994-85929016 AGGAGGAGCTCAAAGTTTCCAGG + Intergenic
1120973930 14:90232453-90232475 AGGAGTAGCCCAAAGTGTCCAGG - Intergenic
1121706294 14:95997294-95997316 AAAAGGAGCCCAAAAAGTCAAGG - Intergenic
1122400818 14:101466280-101466302 AAGAGGCGACCAAGGTGGCCAGG + Intergenic
1122694575 14:103546507-103546529 AAGAGGAGCACAAATTACCCAGG + Intergenic
1123057727 14:105579892-105579914 AGGAGCAGCCCAGAGTGGCCAGG - Intergenic
1123082007 14:105699825-105699847 AGGAGCAGCCCAGAGTGGCCAGG - Intergenic
1123128342 14:105965849-105965871 AGGAGGGGCCCAAAGTGGCCAGG - Intergenic
1123408870 15:20042006-20042028 AGGAGTGGCCCAAAGTGGCCAGG - Intergenic
1123518201 15:21048716-21048738 AGGAGCGGCCCAAAGTGGCCAGG - Intergenic
1124159007 15:27252466-27252488 TAGAGGAGACCAGATTGTCCAGG + Intronic
1125763995 15:42120818-42120840 ATGAGGAGGCCAAAGTGGCCAGG + Intergenic
1126178839 15:45765293-45765315 ATAAGGAGCCCAGAGTGTCCAGG + Intergenic
1126231139 15:46326581-46326603 ATGAGAACCCCAAAGTGGCCTGG + Intergenic
1127339912 15:58030584-58030606 AAGAGGAAGTCAAATTGTCCCGG + Intronic
1127357012 15:58209877-58209899 AGGAGGAGCCCAAAGAGTCCAGG - Intronic
1128243094 15:66114916-66114938 AACAGGGACCCAGAGTGTCCTGG - Intronic
1129545711 15:76392876-76392898 TAGAGGAGCAGAATGTGTCCAGG - Intronic
1129591708 15:76920877-76920899 ACAAGGAACCCAAAGTGTCAAGG + Intergenic
1129953536 15:79612770-79612792 ATGAGGAGTCCAAAGTAACCAGG - Intergenic
1130377137 15:83339186-83339208 CTGAGAAGCCCAAAGTGGCCAGG - Intergenic
1130897246 15:88181174-88181196 AAGAGCTGGCCAATGTGTCCAGG + Intronic
1131658921 15:94492936-94492958 TGGGGGATCCCAAAGTGTCCAGG - Intergenic
1131724238 15:95204444-95204466 AAGAGAAGCCCAAAGTGGCCAGG - Intergenic
1131895679 15:97026916-97026938 ATGAGGAGCCCAAAGTGGCTAGG + Intergenic
1132217835 15:100080268-100080290 GGGAGGAGCCCAAAGTGTCCAGG - Intronic
1135061425 16:19274324-19274346 ATGAGCAGCCCAAAGTGGCCAGG + Intergenic
1136251174 16:29006211-29006233 AGGAGAAGCCTGAAGTGTCCGGG - Intergenic
1137054242 16:35735791-35735813 AAGGGGAGGCCAGAGAGTCCGGG - Intergenic
1138776113 16:59725909-59725931 ATGAGGAACCCCAAGTGGCCAGG + Intronic
1138868606 16:60852418-60852440 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1139237551 16:65355858-65355880 CAGGGGAGCCCAAAGTGACCTGG - Intergenic
1139334604 16:66223075-66223097 CAGAGGAGCCCAATGTGACCAGG + Intergenic
1141535568 16:84677520-84677542 ATGAGGAGCCAGAAGTGACCAGG - Intergenic
1141559308 16:84856392-84856414 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1143695054 17:8608426-8608448 AAGAGGACTCCAAGGTCTCCAGG + Intronic
1145177750 17:20716108-20716130 CACAGGAGCCCAAAGTCTCAGGG - Intergenic
1145999597 17:29123230-29123252 AAGAGGAGCCCGATGGGCCCTGG - Intronic
1146359106 17:32159691-32159713 TAGAGGAGGCCAAAGTGGCAGGG - Intronic
1146505874 17:33405028-33405050 AACATTAGCCCAGAGTGTCCTGG - Intronic
1146758658 17:35455777-35455799 AGGAGGTGCCCAAAGTGTCCAGG - Intergenic
1147355477 17:39892656-39892678 ATATGGAGCCCAAAATGTCCAGG + Intergenic
1147360437 17:39926831-39926853 AAGAGGAGCACAAAACATCCAGG + Exonic
1148635463 17:49145867-49145889 AGGAGGAGTCCAAAGTGTCCAGG + Intronic
1148795524 17:50194949-50194971 AAGAGGAGCCCCTAGTCTTCTGG - Intronic
1149255109 17:54817086-54817108 AGGAGAAGCCCAAAGTGTCCAGG - Intergenic
1149427281 17:56567352-56567374 ATGAGGAGCCCAAAGTGGCCAGG - Intergenic
1149837458 17:59926054-59926076 GACAGGAGCCCAAAGTCTCAGGG - Intronic
1150550823 17:66208222-66208244 AAAAGGAGCCCAAAGTTGCCAGG - Intergenic
1150921909 17:69492759-69492781 AAGATGAGCCTAAATTATCCAGG - Intronic
1151037582 17:70819976-70819998 AGGAGGATCCCAAAGTGTCCAGG + Intergenic
1151451566 17:74201150-74201172 AAGATGAGCCCCAAATGTCCTGG - Intergenic
1151728999 17:75899983-75900005 AAAAGCAGCCAAAAGTGGCCTGG - Intronic
1152407947 17:80108162-80108184 ACGAGGAGCTCAGAGTGGCCTGG - Intergenic
1153089949 18:1331803-1331825 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1153131044 18:1856086-1856108 TGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1153217456 18:2833968-2833990 AGGAGGAGCCCAAAGTGTCTGGG + Intergenic
1154068689 18:11132725-11132747 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1154252332 18:12755116-12755138 AAGAGGAGCCCAAAATGTCCAGG + Intergenic
1154273023 18:12936286-12936308 ATGAGGAGCCCCAAGTGGCTGGG + Intergenic
1154505576 18:15037393-15037415 ATGAGGAGTTCAAAGTGGCCAGG - Intergenic
1155357821 18:24970551-24970573 AAAAGTAGCCCAGATTGTCCAGG + Intergenic
1155741725 18:29297671-29297693 AGGAGGAGCCCAAAGTGGCCAGG + Intergenic
1156118654 18:33817345-33817367 ATGAGGATTCCAAAGTGGCCAGG - Intergenic
1156304076 18:35860338-35860360 AGGAGGAGCCCAAAGTGGCCAGG - Intergenic
1156443396 18:37215097-37215119 AAGAGGAAGTCAAATTGTCCAGG - Intronic
1156452827 18:37276120-37276142 CAGACGCCCCCAAAGTGTCCAGG - Intronic
1156537794 18:37880566-37880588 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1156990087 18:43399140-43399162 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1156998805 18:43499371-43499393 AGGAGGAGCCCAAAGTACCCAGG - Intergenic
1157223814 18:45845460-45845482 AAGAGCAGCCCAGAGGGTCTGGG - Intergenic
1157336838 18:46746261-46746283 AAGAGGAAATCAAATTGTCCCGG + Intronic
1157341437 18:46781655-46781677 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1157955271 18:52089924-52089946 ATATGGAGACCAAAGTGTCCAGG - Intergenic
1157998280 18:52586482-52586504 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1158671381 18:59477085-59477107 ATGAGGAGACCAAAGTAGCCAGG - Intronic
1159207692 18:65274723-65274745 ATGAAGAGCCCAAAGTCTCTGGG - Intergenic
1159288002 18:66377113-66377135 AGGAGGAGCTCAAAGTGTCCAGG - Intergenic
1159558880 18:69973738-69973760 AGGAGGAGCCCAAAGTGTTTAGG + Intergenic
1159706301 18:71692811-71692833 GGAAGGAGCCCAAAGTGCCCAGG + Intergenic
1159711563 18:71766076-71766098 AGGAGGAGCCCAAAGTTGCCAGG - Intronic
1160092667 18:75841644-75841666 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1160251470 18:77207116-77207138 AGGAGCATCCAAAAGTGTCCCGG - Intergenic
1160433099 18:78825814-78825836 AAGAGGAGCTCACTGTGTCCTGG - Intergenic
1162070942 19:8151691-8151713 AAGAGGTGTCCAAGGTGGCCGGG - Intronic
1163000406 19:14363392-14363414 AAGAGGAGGACAAAGGGGCCCGG - Intergenic
1164271552 19:23677226-23677248 AAGAGGAACTCAAACTATCCCGG + Intronic
1165186520 19:34027135-34027157 AAGAGAAGCACAAAGTGTTATGG - Intergenic
1165339086 19:35197749-35197771 ATGAGGAGCCCAAAGTAGCCAGG - Intergenic
1166978481 19:46619080-46619102 AAAAGGAAACCAAGGTGTCCCGG + Intergenic
1168291120 19:55358251-55358273 AAGACGACCCCACAGTGGCCAGG + Exonic
1168539105 19:57195770-57195792 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
925105322 2:1286058-1286080 AGGAGAAGCCCAAAGTGTCCAGG + Intronic
925280185 2:2678492-2678514 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
925460964 2:4062088-4062110 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
925499175 2:4485290-4485312 AGGAGGAACCCAAAGTGTCTAGG + Intergenic
925772518 2:7297376-7297398 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
926810167 2:16749068-16749090 TGGAGGAGCCCAAAGTGTCCAGG + Intergenic
926826990 2:16915306-16915328 AGGAGAAGCCCAAAGTGTCCAGG - Intergenic
927008937 2:18881346-18881368 AGGTGGAGCCCAAAGTGTCCAGG - Intergenic
929269598 2:39959160-39959182 AGGAGGAGCCCAAAGTGGCCAGG + Intergenic
930294977 2:49543735-49543757 AGGAGGAGCCCAAAGCGCCCAGG + Intergenic
930480946 2:51947624-51947646 AGGAGGAGCCCAAAGTGGCCAGG + Intergenic
930536397 2:52650621-52650643 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
930910358 2:56622508-56622530 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
933394244 2:81711717-81711739 AGGAGGAGCCCAAAGTGCCCAGG + Intergenic
933504557 2:83161127-83161149 ATGAGGAGCCCAAAGTGTCCAGG + Intergenic
934606181 2:95697111-95697133 GAGATCTGCCCAAAGTGTCCTGG + Intergenic
935184170 2:100716513-100716535 AGAAGGATCCCAAAGTGGCCAGG - Intergenic
935424881 2:102909692-102909714 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
936539589 2:113339327-113339349 GAGATCTGCCCAAAGTGTCCTGG + Intergenic
936641440 2:114316335-114316357 AGAAGAAGCCCAAAGTGGCCAGG - Intergenic
937332701 2:121042261-121042283 AAGAGGAGCCCAAGGTCTGCGGG + Intergenic
937530783 2:122824606-122824628 AACAGGAGTCCAAAGACTCCTGG + Intergenic
937581844 2:123497495-123497517 AGGAGGAACCCAAAGTGTCTAGG + Intergenic
937765857 2:125659639-125659661 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
937784981 2:125886087-125886109 AGAAGGAGCTCAAAGTGTCCAGG + Intergenic
937852350 2:126647110-126647132 AGGAGGATCCCAAAGTGTCCAGG + Intergenic
938504765 2:131867657-131867679 ATGAGGAGTTCAAAGTGGCCAGG - Intergenic
938755715 2:134377238-134377260 AAGGAGAGACCAAAGTGGCCTGG - Intronic
939214092 2:139213882-139213904 AGGAGGAGCCCAAAGTATCCAGG - Intergenic
939788452 2:146544470-146544492 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
939806464 2:146780103-146780125 AGGAGAAGCTCAAAGTGGCCAGG - Intergenic
940254035 2:151710320-151710342 AAGAGGGGCCTCAAGTGTTCTGG + Intronic
940471863 2:154111479-154111501 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
940544156 2:155062050-155062072 ATGAGGAGCCCAAAGTGGCTGGG + Intergenic
940676727 2:156732545-156732567 ATGAGGAGCCCAAAGTGACCAGG - Intergenic
941330439 2:164172924-164172946 AGGAGAAGCCCAAGGAGTCCAGG + Intergenic
941387014 2:164866244-164866266 AGAAGGAGCCAAAAGTGTCCAGG - Intergenic
941668251 2:168262742-168262764 AGGAGGGGCCCAAAGTGTCCAGG - Intergenic
942322157 2:174745184-174745206 ATGAGGAGCTCGAAGTGGCCAGG - Intergenic
942951741 2:181729273-181729295 ACAAGGAGTCCAAAGTGCCCTGG + Intergenic
943021158 2:182575396-182575418 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
943182501 2:184561284-184561306 AGGAGGAGCCCAAAGTGGCCAGG - Intergenic
943239057 2:185361346-185361368 AGGAGGAGGCCAAAGTGTCCAGG + Intergenic
943263753 2:185698877-185698899 ACGAGGAGCCCAAAGTGGTCTGG - Intergenic
943383843 2:187179450-187179472 AGGAGAAGCCCAAAGTGTCCAGG + Intergenic
943517360 2:188905613-188905635 AGGAGAAGGCCAAAGTATCCAGG + Intergenic
943833392 2:192489487-192489509 AGAAGGAACCCAAAGTGTCCAGG + Intergenic
945357350 2:208856335-208856357 GAGAGGAGCCCACACTTTCCAGG - Intergenic
945642406 2:212445481-212445503 AGGAGGATCCTAAAGTGTCTAGG - Intronic
945725625 2:213469858-213469880 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
946478613 2:220032612-220032634 ACAAGGAGCCCAAAGTGACTAGG - Intergenic
946527647 2:220538447-220538469 AGGAGGAGCCCAAAGTGTTCAGG + Intergenic
946533885 2:220606245-220606267 AGGAGGAGCCCAAAGTGGCCAGG + Intergenic
947281796 2:228463367-228463389 AGGAGAAGCCCAAAGTGTCCAGG + Intergenic
947441079 2:230121896-230121918 AGGAGGAGCCCAAAGTGTCGAGG - Intergenic
948170771 2:235900333-235900355 AGGAGGAGCCCAAAGTGGCCAGG + Intronic
948401025 2:237685579-237685601 ATGAGGACACCAAAGTGGCCAGG - Intronic
1168787653 20:553701-553723 TAGAAAAGCCCAAAGTGGCCAGG + Intergenic
1169909636 20:10636903-10636925 AAGATGAGCTTTAAGTGTCCTGG - Intergenic
1170937416 20:20822209-20822231 AAGAGGAACCCAAAGTGATAAGG + Intergenic
1171465328 20:25323943-25323965 AAGGGGATTCCAAAGTTTCCAGG + Intronic
1172428741 20:34873450-34873472 AAGAGGAGTCAGAAGTGTCGGGG - Intronic
1172891856 20:38271344-38271366 CAGAGGAGCCCAAAGTAATCAGG - Intronic
1174411612 20:50340262-50340284 AAGAGGAGCCCAGTGTGGCAGGG - Intergenic
1174531525 20:51218155-51218177 AGGAAGAGCCCAAAGTGGCTAGG - Intergenic
1176278064 20:64285809-64285831 AAGAGGACCCCGCAGTGCCCTGG + Intronic
1176792283 21:13331725-13331747 ATGAGGAGTTCAAAGTGCCCAGG + Intergenic
1176998394 21:15581901-15581923 AGGAGGAGCCTAAAGTGTCCAGG - Intergenic
1177139193 21:17340623-17340645 AGGAGAAGCCCAAAGTGTCCAGG + Intergenic
1177267937 21:18808581-18808603 AAAAGGAGACCAAAGTGTCCAGG - Intergenic
1177505337 21:22012578-22012600 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1177913407 21:27057861-27057883 AGGAGAAGCCCAAAGTGTCCAGG - Intergenic
1178005812 21:28218793-28218815 AGCAAGAGCCCAAAGTGTCCAGG + Intergenic
1178061917 21:28862001-28862023 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1178634600 21:34291158-34291180 ATGAGGAGCCCAAAGTGGCTAGG - Intergenic
1178814423 21:35914928-35914950 AACATGTGCCCAAAGTGTTCAGG + Intronic
1179078103 21:38143008-38143030 AAGATGATGCCAAAGTGTCTTGG + Intronic
1179414912 21:41190891-41190913 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1179997657 21:44981379-44981401 AACCGGGGCCCAAAGTGTCCAGG - Intergenic
1180172721 21:46068076-46068098 ATAAGGAGTCCAAAGTGCCCTGG + Intergenic
1181005241 22:20010333-20010355 ACCAGGAGCACACAGTGTCCAGG + Intronic
1181367089 22:22386255-22386277 AGGAGAAGCCCAAAATGTCCAGG + Intergenic
1181373492 22:22437537-22437559 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1181429675 22:22871470-22871492 GACAGGAGCTCATAGTGTCCAGG + Intronic
1181543909 22:23590015-23590037 ATAAGGAGCCCACAGTGGCCAGG + Intergenic
1181664926 22:24388037-24388059 AAGAGGATCCTGAATTGTCCAGG - Intronic
1182951636 22:34381687-34381709 AAGAGGAGCCCTAAGGAACCAGG + Intergenic
1182965905 22:34520719-34520741 AGGAGAAGCCCGAAGTGTCCGGG - Intergenic
1183036484 22:35144478-35144500 AGGAGTAACCCAAAGTGTCCTGG - Intergenic
1183403765 22:37619903-37619925 AAGAGGAGCCAGAGGTCTCCAGG - Intronic
1184465555 22:44667469-44667491 CAGAGGGGCCTAAAGTGTCTGGG - Intergenic
1184541428 22:45128193-45128215 ATGAGGAGCCCAAAGTGACTGGG - Intergenic
1184603324 22:45556721-45556743 AGGAGGAGCTTCAAGTGTCCAGG + Intronic
1185114654 22:48925203-48925225 ATGAGGAGTTCAAAGTGGCCAGG - Intergenic
1185141876 22:49107023-49107045 AACAGGAGCCCAGTGTCTCCAGG - Intergenic
949125432 3:441450-441472 AAGAGGAGTCCAAAGTGTCCAGG + Intergenic
949169803 3:984965-984987 AGGAGGAGACCAAAGTGTCCAGG + Intergenic
949246103 3:1926538-1926560 AGGAGGACCCCAAAGTGTCCAGG - Intergenic
949417360 3:3829268-3829290 AGAGGGAGCCCAAAGTGTCCAGG + Intronic
949425641 3:3912980-3913002 AAGAGGAAGTCAAATTGTCCTGG + Intronic
949445842 3:4132702-4132724 CGGAGGAGCCCAAAGTGTCCAGG - Intronic
949639131 3:6015163-6015185 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
950776588 3:15355695-15355717 CAGAGCAGCCCTAAGTGCCCGGG + Intergenic
951003789 3:17594129-17594151 AGGAGGTGCCCAAAGTGTCCAGG - Intronic
951086772 3:18520917-18520939 AGGAGGAACCCAAAGTCTCCAGG - Intergenic
951104631 3:18728605-18728627 AGGAGGAGCCAAAAGTGTCCAGG - Intergenic
951384749 3:22029159-22029181 AGGAGGAGCACAAAGTGTCCAGG - Intronic
951970552 3:28440252-28440274 AGGAGAAGCCCAAAGTGTCCAGG + Intronic
952313179 3:32208999-32209021 AGGAGGAGCCCAAAGTGACCAGG + Intergenic
952621335 3:35346865-35346887 AAGAGGAGCTCAAGGAGTACTGG - Intergenic
952809680 3:37390554-37390576 AAAAAGAGCCCAAATAGTCCAGG - Intronic
953804923 3:46060515-46060537 AAGAGGAGCCCAAAGTGGCAGGG + Intergenic
954054439 3:48009906-48009928 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
954511267 3:51128047-51128069 AGGAGGATCCCAAAGTGTCCAGG + Intronic
955418418 3:58714217-58714239 AAGAGAAGCCCTAAGTGGCTGGG + Intergenic
956307088 3:67837273-67837295 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
956360378 3:68440874-68440896 TAGAGGAGCCCAAAGTGTCCAGG + Intronic
956703674 3:71981258-71981280 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
957634445 3:82762066-82762088 AAGAGAAGGCCAAAGTGAACAGG - Intergenic
957689841 3:83553619-83553641 AGGAAGAGCCCAAAGTGGCCAGG + Intergenic
957703689 3:83752303-83752325 ATGAGGAGCCCAAAATTGCCAGG - Intergenic
957754805 3:84471071-84471093 AGAAGGAGCACAAAGTGTCCAGG - Intergenic
958487462 3:94730831-94730853 AGGAGGAACCCAAAGTTTCCAGG + Intergenic
958667438 3:97159306-97159328 ATGAGAAGCACAAAGTGGCCAGG + Intronic
958845559 3:99260785-99260807 AGGAGGAGCCCAAAGTGACCAGG + Intergenic
958964913 3:100548526-100548548 AGGAGGAGCCCGCAGTGACCAGG - Intronic
959289217 3:104450950-104450972 AGCAGGAGCCCAAAGTGGCCAGG + Intergenic
959352142 3:105279187-105279209 ATGAGGAACCCAAAGTGGCCAGG + Intergenic
959362772 3:105415030-105415052 CAGAGGAGGCCAAACTATCCAGG - Intronic
959602887 3:108208747-108208769 ATGAGGAGCCCAAAGTGGCCAGG - Intronic
959745793 3:109775635-109775657 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
960126043 3:113999323-113999345 ACAAGGAGCCGAAAGTGGCCAGG - Intronic
960349741 3:116577344-116577366 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
960494524 3:118359118-118359140 AGGAGGAGCACAAAGTGTCCAGG + Intergenic
961213583 3:125143401-125143423 AAGAGGCCCCCAAAGAGTCCTGG + Intronic
961263078 3:125618039-125618061 AGGAGGAGCCAAAAGTGTTCAGG - Intergenic
961699963 3:128735703-128735725 AAGAGGAGCCCACAATGGGCTGG - Intronic
962525705 3:136235698-136235720 ACAAGGAGTCCAAAGTGCCCTGG - Intergenic
963331588 3:143921756-143921778 AGGAGGAACCGAAAGTGTCCAGG + Intergenic
963355430 3:144205221-144205243 AGGAGGAACCTAAAGTGTCCAGG + Intergenic
963379022 3:144505642-144505664 AGGAGGAGCTCAAAGTGTCCAGG + Intergenic
963420746 3:145057975-145057997 ATGAGGACTCCAAAGTGGCCAGG - Intergenic
963630532 3:147724858-147724880 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
963970088 3:151420316-151420338 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
964146733 3:153472980-153473002 AGGAGGATCCCAAAGTGTCCAGG - Intergenic
964679007 3:159317271-159317293 AGGAGAAGCCCAAAGTGTCCAGG + Intronic
965034781 3:163424295-163424317 AGGAGGAGCCCAAACTGTCCAGG + Intergenic
965071222 3:163917309-163917331 AGGAAGAGCCCCAAGTGGCCAGG - Intergenic
965226536 3:165999135-165999157 AGGAGGAGCCCAAAGTATCCAGG + Intergenic
965996003 3:174884031-174884053 AGGAGGAGCCCGAAGAGTCCAGG + Intronic
966445915 3:180000213-180000235 AGGAGGAGCTCAAAGTGTCCAGG - Intronic
966799307 3:183748157-183748179 GAGAGGAGCCACAAGTTTCCTGG - Intronic
967130356 3:186464944-186464966 ACGAGGAGCCCAAAGTGCCTAGG - Intergenic
967408547 3:189143940-189143962 AAGAGGAAAGCAAAGTGTCTGGG - Intronic
967676196 3:192301648-192301670 AAGATGAGCACAAATTGGCCAGG + Intronic
967826289 3:193880153-193880175 AAGAACACCCAAAAGTGTCCAGG + Intergenic
967832018 3:193927628-193927650 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
968800420 4:2739771-2739793 AGGAGGAGCCCAGAGTGTCCAGG - Intergenic
968907247 4:3460053-3460075 AGGAGGAGCCCAGAGTGTCCAGG - Intergenic
969549070 4:7852366-7852388 ACGAGGAGCCCAGTGTGGCCAGG - Intronic
969624289 4:8294502-8294524 GAGAGGAGCCCAGGGAGTCCAGG - Intronic
970023210 4:11592414-11592436 AAGATGAGCCCCATTTGTCCAGG - Intergenic
970486058 4:16525972-16525994 GAGAGGAGCCTGAATTGTCCAGG + Intronic
970644851 4:18108330-18108352 AAGAGGAGCCCAAAGTGGCCAGG + Intergenic
970704451 4:18783257-18783279 AGGAGAAGCCCAAAGTGTCCAGG - Intergenic
970729724 4:19088675-19088697 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
971460296 4:26888952-26888974 ATGAGGAGTTCAAAGTGGCCAGG + Intronic
971687157 4:29785451-29785473 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
971857443 4:32061207-32061229 AGGAGGAGCCCAAAGTGGCCAGG + Intergenic
971897743 4:32619044-32619066 AGGGGGAGCCCAAAGTGGCTGGG - Intergenic
972085433 4:35208726-35208748 AGGAAAAGCCCAAAGTGTCCAGG - Intergenic
972201077 4:36715565-36715587 AGGAGGAGCCCAAATTGCCCAGG + Intergenic
972244520 4:37230617-37230639 AAGAGGAGACCAAGGTGAGCTGG - Intergenic
972323143 4:37991323-37991345 AAGAACAGTCCACAGTGTCCTGG + Intronic
972806155 4:42531017-42531039 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
972882757 4:43446529-43446551 AGGTGGAGCCCAAAGTGTCCAGG + Intergenic
973092801 4:46158724-46158746 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
973103139 4:46296386-46296408 AGCAGGAACCCAAAGTGTCCAGG - Intronic
973120785 4:46519275-46519297 AGGAGAAGCCCAACATGTCCAGG + Intergenic
974289785 4:59914376-59914398 AGGAAGAGCCCAAAGTGTCCAGG - Intergenic
974459231 4:62165895-62165917 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
974727448 4:65814179-65814201 AGGAGGAGTCCAAAGTGTCCAGG - Intergenic
975024725 4:69533858-69533880 AGGAGGAGCCCAAAGTGGCCAGG - Intergenic
975399268 4:73915915-73915937 ATGAGGAACCCAAAGTGACCAGG - Intergenic
976324131 4:83751526-83751548 ATGAGGACCCCAGAGTGGCCAGG - Intergenic
977080469 4:92520750-92520772 GTGAGGAGCTCAAAGTGGCCAGG + Intronic
977430989 4:96929836-96929858 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
977489866 4:97698437-97698459 AGGAGGAGCACAAAGTGTCCAGG + Intronic
977833001 4:101616200-101616222 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
977898931 4:102396229-102396251 AGGAGGAGCCCAAAGTGTCGAGG - Intronic
977930181 4:102742179-102742201 AGGAGGAGCCCGAAGTGTCCAGG + Intronic
978311774 4:107392174-107392196 AAGAGGAGTCCAAATTAGCCAGG - Intergenic
978341344 4:107723908-107723930 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
978771921 4:112466144-112466166 AGGAGGAGCCCAGAGTGTCCAGG + Intergenic
978898841 4:113925185-113925207 AGGAGGAACCCAAAGTGTCCAGG + Intronic
979051885 4:115945206-115945228 ATAAGGAGCCCAAAGTGGCCAGG - Intergenic
979138766 4:117146422-117146444 AGGAGGAGCCCAAAGTTTCCAGG - Intergenic
979400049 4:120238234-120238256 AACAGGAGCCAAAAGTGACAAGG - Intergenic
979507342 4:121513658-121513680 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
979600706 4:122583913-122583935 AAGTGGGATCCAAAGTGTCCCGG + Intergenic
980091000 4:128442741-128442763 AAGAGGAGGCCAGAGTGGCCAGG - Intergenic
980284239 4:130760909-130760931 ATGAGGAACCCAAAGTAACCAGG + Intergenic
980385576 4:132085411-132085433 AGGAGAAGCCCAAAGTGGCCAGG + Intergenic
980497408 4:133604428-133604450 AGTAGGAGCCCAAAGGGTCCAGG + Intergenic
980513688 4:133825546-133825568 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
980602438 4:135041647-135041669 AGGAGGAGCGCAAAGTGTCCAGG - Intergenic
980629738 4:135415908-135415930 AGGAGAAGCCCAAAATGTCCAGG - Intergenic
980957955 4:139447550-139447572 AGGAGGAGCCCCAAGTGTCCAGG - Intergenic
981158230 4:141465342-141465364 AGGAGGAGCCCAGTGTGGCCAGG + Intergenic
981278044 4:142924415-142924437 AAGAGCAACCCAAAGACTCCAGG + Intergenic
981463034 4:145033419-145033441 AAGAGGAGCCCAAAGTGTACAGG - Intronic
981605641 4:146537457-146537479 AGGAGGAGTCCAAAGTGTCCAGG + Intergenic
981835226 4:149045544-149045566 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
981912434 4:149997134-149997156 AAGAGTAGCTCAGATTGTCCAGG + Intergenic
981979175 4:150771028-150771050 AGGAGGAGCCCAAAGTGGCTGGG + Intronic
982208981 4:153019854-153019876 GGGAGAAGCCCAAAGTGTTCTGG - Intergenic
982623109 4:157731249-157731271 AGGAGTAGCCCAAAGTGTCCAGG + Intergenic
982848011 4:160275964-160275986 AGGAGGAGCCCAAAGTGTTCAGG - Intergenic
983027629 4:162756926-162756948 AAGAGGATCCCAAAGTGTCCAGG - Intergenic
983582911 4:169326456-169326478 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
984060062 4:174980395-174980417 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
984205728 4:176785608-176785630 GAGAGAACCCTAAAGTGTCCTGG - Intronic
984329452 4:178296795-178296817 CACAGGAGCCCAAAATATCCAGG - Intergenic
985040379 4:185885812-185885834 AAGATGTGCCCAGAGTGTCATGG - Intronic
985076434 4:186219992-186220014 AAAAGGATCTCAAAGTGTCCAGG + Intronic
985832541 5:2244960-2244982 AGGAGGAGCTCAAAGTGTCCAGG - Intergenic
985950659 5:3219432-3219454 ATGAGGACCCCAAAGTGCACAGG - Intergenic
985953673 5:3243829-3243851 ATGAGGAGCCCAAAGTGGCTGGG + Intergenic
986036820 5:3948811-3948833 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
986087358 5:4464529-4464551 AGGAGGAGTCCAAAGTGTCCAGG - Intergenic
986147415 5:5091625-5091647 AGGAGGAGCCCGAAGTGTCCAGG + Intergenic
986261414 5:6150883-6150905 AGGAGGAGCCAAAAGTGTCCAGG + Intergenic
986531180 5:8738695-8738717 AGGAGAAGCCCAAAGTGTCCAGG + Intergenic
986743175 5:10721408-10721430 AATAAGAGCCCAAAGTGTCCAGG - Intronic
986806572 5:11313415-11313437 AAGAAGGGCCCAGAGTGTCGGGG - Intronic
986960055 5:13200813-13200835 GGAAGGAGGCCAAAGTGTCCAGG - Intergenic
987466324 5:18276105-18276127 AGAAGGAGCTCAAAGTGGCCAGG - Intergenic
987468023 5:18295720-18295742 GGAAGGAGCCCAAAGTGTCCAGG + Intergenic
987504611 5:18751480-18751502 AAGAGGAGCCCAAAGTGTCCAGG - Intergenic
987646163 5:20675328-20675350 ATTAGTAGCCCAAAGTGGCCAGG + Intergenic
987737049 5:21859733-21859755 AGCAGGAGCCCAAACTGGCCAGG - Intronic
987737933 5:21869079-21869101 ATGAGGAGCCCAAAGTATCCTGG - Intronic
987964933 5:24860287-24860309 AAGAAGAGCACAATGTGGCCAGG + Intergenic
988056542 5:26105031-26105053 AGGAGGAGCCCAAAGTGTCTAGG + Intergenic
988092652 5:26562934-26562956 AAGAGGAGCCCAAAGTGTCCAGG - Intergenic
988160601 5:27515228-27515250 AGGAGGAGCCTAAACTCTCCGGG + Intergenic
988228974 5:28449760-28449782 AGGAAGAGCCCAAAGTGTCCAGG - Intergenic
988233087 5:28505449-28505471 AGGAGGAGTCCAAAGTGTCCAGG + Intergenic
988267525 5:28971658-28971680 AAGAAAAGCCCAAAGTGTACAGG + Intergenic
988562354 5:32292476-32292498 AGGAGGGGCCCAAAGTGTCCGGG - Intronic
988768810 5:34410425-34410447 AACATGAGCCCAAAGTGGTCAGG + Intergenic
988785305 5:34561312-34561334 AGGAGGAGCCAAAGGTGTCCAGG + Intergenic
988959887 5:36359225-36359247 ATGAGGACCCCAAAGTGTGAGGG + Intergenic
989044922 5:37265641-37265663 AGGAGGAGCGCAAAGTGTCCAGG + Intergenic
989307278 5:39972980-39973002 AGGAGGAGCCCAAGGTGTCCAGG + Intergenic
989486156 5:41994722-41994744 GGGAGGAGCCCAAAATGTCCAGG + Intergenic
989511064 5:42288151-42288173 ACAAGGGGGCCAAAGTGTCCAGG + Intergenic
991013562 5:61909251-61909273 AAGAGGAGCCCAAAGTGTCCAGG + Intergenic
991033783 5:62107562-62107584 AAGAGGAGCCCAAAGTGTTCAGG - Intergenic
991330523 5:65488081-65488103 AGGAGGAGCTCAAAGTGTCCAGG + Intergenic
991946371 5:71901764-71901786 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
992109645 5:73481054-73481076 ATGAGGAACCCAAAGTGTCCAGG + Intergenic
992533152 5:77671600-77671622 AAAAGGAGGCCACAGTGCCCAGG + Intergenic
993132691 5:83919270-83919292 AAAAGGAGCCCAAAGTGGCTGGG - Intergenic
993203620 5:84849182-84849204 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
993367116 5:87048223-87048245 AGGAGGATCCCAAAGTGTCCAGG + Intergenic
993412355 5:87590176-87590198 AGGAGAAGCCAAAACTGTCCAGG + Intergenic
993792003 5:92220547-92220569 GATAGGAGCCCAAAGTTTCCAGG - Intergenic
994291145 5:98030316-98030338 ATGAGGAGCCCAAAGTGTCCAGG + Intergenic
994320098 5:98385547-98385569 ATGAGCATCCCAAAGTGTCAAGG - Intergenic
994605014 5:101955825-101955847 AGGAGGAGCACGAAGTGTCCAGG + Intergenic
994837169 5:104870841-104870863 AGCAGGAGCCCAAAGTGTCCAGG - Intergenic
994984190 5:106914098-106914120 AGGAGGAGCCAAAAGTGTCCAGG + Intergenic
995427511 5:112042109-112042131 AGAAGGAGCCCAAAGTATACAGG + Intergenic
995776048 5:115726070-115726092 AGGAGGAGCCCGAAGTGTCCAGG + Intergenic
996018789 5:118569513-118569535 GGGAGGAGCCCAAAGTGGCCAGG - Intergenic
996386102 5:122912417-122912439 AAGAGGAAGTCAAATTGTCCCGG - Intronic
996570557 5:124928869-124928891 AAAAGGAGCCCTAAGTGACTTGG + Intergenic
996825794 5:127679458-127679480 AGGAGGAGCCCAAACTGTCCAGG - Intergenic
997920314 5:137972654-137972676 AAGAGGAAGTCAAATTGTCCCGG + Intronic
998362669 5:141603029-141603051 AAGAGGGGCACAAAATGACCAGG + Intronic
1000417246 5:160995844-160995866 AGGAAGAGCCCAAAGTGTCCAGG - Intergenic
1000499341 5:162029635-162029657 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1000762322 5:165241709-165241731 ATGAGGAGCCCAAAGTGTTCAGG + Intergenic
1001618971 5:173065929-173065951 AAGAGAAACCCAAAGGGGCCAGG - Intronic
1002032712 5:176442312-176442334 ATGAGGTGTCCAAAGTGTCCAGG + Intergenic
1002428787 5:179191331-179191353 AAGAGGGGCCCTAAGTGGCCAGG + Intronic
1002754831 6:148732-148754 AAGAGGACCCCGCAGTGCCCTGG - Intergenic
1002820582 6:720720-720742 AAGAGGGGCATTAAGTGTCCAGG + Intergenic
1002998209 6:2306406-2306428 AGCAGGAGTCCAAAGTGTCCAGG - Intergenic
1003695668 6:8404522-8404544 AGAAGGAGCCCAAAGTGTCCAGG + Intergenic
1003758836 6:9151729-9151751 AGGAGAAGCCTAAAGTGTCCAGG - Intergenic
1006001775 6:30970707-30970729 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
1006027853 6:31158639-31158661 CCGAGGAGCCCAAGGGGTCCCGG + Exonic
1006062563 6:31434836-31434858 AGGAGGAGCCCAAAGTATCCAGG - Intergenic
1007214191 6:40223763-40223785 ATGACGAGCCCAGAGTGACCAGG + Intergenic
1007265450 6:40592268-40592290 AAGAGAAGGACAAGGTGTCCAGG + Intergenic
1007838650 6:44697573-44697595 AAGAGGAGCCCAAGAGGCCCTGG - Intergenic
1008079156 6:47176926-47176948 AAGAGAAGCCCAAAGTGGCCAGG + Intergenic
1008284403 6:49629985-49630007 AAGAGGTTCCCACAGTGCCCTGG + Intronic
1008340477 6:50357918-50357940 AGGAGGAGCTCTAAGTGTCCAGG - Intergenic
1008400499 6:51057074-51057096 AGGAGGAATCCAAAGTGTCCAGG - Intergenic
1008820615 6:55626770-55626792 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1009806706 6:68608587-68608609 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
1010291916 6:74147401-74147423 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1010299905 6:74247375-74247397 AAGAGGAAGTCAAATTGTCCCGG + Intergenic
1010320110 6:74497107-74497129 AAGAGGAAGTCAAATTGTCCCGG - Intergenic
1010323791 6:74542125-74542147 AGGGGGAGCCCAAAGTGTCCAGG - Intergenic
1010325841 6:74561029-74561051 AGCAGGAGCCCAAAGTGGCCAGG - Intergenic
1010406796 6:75515260-75515282 ATGAGGAGCCCAAAATGGCCAGG + Intergenic
1010818854 6:80390043-80390065 AAGAGGACCCCAAAGTGTCCAGG - Intergenic
1011069326 6:83363292-83363314 ATGAGGAGCCCAAAGTATCTAGG - Intronic
1012002154 6:93666546-93666568 AGGTGGAGCCCAAAGTGGCCAGG - Intergenic
1012002774 6:93674761-93674783 ATGAGGAACCCAAAATGGCCAGG - Intergenic
1012344806 6:98171924-98171946 AGGAGGATCCCAAAGTGTCCAGG - Intergenic
1012362819 6:98405020-98405042 ATGAGGAGTCCAAAGTGGTCAGG + Intergenic
1012730663 6:102875919-102875941 AGGAGAAACCCAAAGTGTCCAGG - Intergenic
1012747760 6:103116565-103116587 ATGAGGATCCCAAAGTGGTCAGG - Intergenic
1012821004 6:104084405-104084427 AGGGGAAGCCCAAAGTGTTCAGG - Intergenic
1012920558 6:105217911-105217933 AGGAGTAGTCCAAAGTGTTCAGG + Intergenic
1013222097 6:108087249-108087271 AGAGGGAGCCCAAAGTGGCCAGG - Intronic
1014173518 6:118306156-118306178 ATGAGGAGCCCAAAATGGCCAGG + Intronic
1014417219 6:121197052-121197074 AGGAGAAACCCAAAGTATCCAGG - Intronic
1014455947 6:121635166-121635188 AGGAGAAGCCCAAAGTGTCCAGG - Intergenic
1014533965 6:122594959-122594981 AGAAGGACCCCAAAGTGTCCAGG + Intronic
1014895847 6:126898214-126898236 GTAAGGAGCCCAAAGTGACCAGG - Intergenic
1014913252 6:127118404-127118426 AAGAGGCGCCTAAGGGGTCCCGG - Intergenic
1015443056 6:133270909-133270931 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1015473143 6:133629111-133629133 ATGAGGAGCCCAAAGTGGCCAGG - Intergenic
1015475983 6:133659132-133659154 AGGAGGAGCCCAAACTATCCAGG - Intergenic
1015479188 6:133689541-133689563 ATGGGAAGCCCAAAGTGGCCGGG + Intergenic
1015527452 6:134187231-134187253 ATGAGGATCCCAAAGTGGCTGGG + Intronic
1016119722 6:140331041-140331063 AGGAGGACTCCAAAGTGTCCGGG + Intergenic
1016157810 6:140834639-140834661 ATAAGGAGCACAAAATGTCCAGG - Intergenic
1016576043 6:145570945-145570967 AGGAGGAGACCAAAGTGTCCAGG + Intronic
1016594794 6:145787148-145787170 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
1016909012 6:149178649-149178671 AAGAGGAGCCCTAGGTTCCCGGG + Intergenic
1017452557 6:154567309-154567331 ATGAGGAGCCCAAAGTGGCTGGG - Intergenic
1017535904 6:155348336-155348358 AAGAGGAGCCCACACTTTCAGGG - Intergenic
1017558827 6:155604906-155604928 AGGAGGAGCCCAAAGAGTACAGG + Intergenic
1017766286 6:157609823-157609845 AAGAAGAGCCCAAAGTGTCAAGG + Intronic
1018425474 6:163676510-163676532 AGGAGGAGCCCCAAGTGGCCAGG - Intergenic
1018534814 6:164808879-164808901 AGGAGGAGCCCAAAGTGCCCAGG + Intergenic
1018540974 6:164878757-164878779 GTGAGGAGCCTAAAGTGGCCAGG - Intergenic
1018604580 6:165583987-165584009 CTGAGGAGCCCAAAGTGACTGGG - Intronic
1018780901 6:167064423-167064445 AGGAGTAGCCCAAAGTGTCCAGG + Intergenic
1020199903 7:6071568-6071590 AAGAGGAACTGAAAGTGGCCAGG + Intergenic
1020567547 7:9817214-9817236 AAGAGGAGCCCAAAGTGTCCAGG + Intergenic
1020583129 7:10031005-10031027 TTGAGGAGCCCAAAGTGGCTAGG + Intergenic
1020662727 7:11001753-11001775 AAGAGTAGCCAAAAATTTCCTGG - Intronic
1020710533 7:11598914-11598936 AGAAGGAGCCCAAAGTGTCCAGG - Intronic
1021989046 7:26124566-26124588 AGGAGGATCCCAAAGTGTCCAGG - Intergenic
1022995835 7:35754570-35754592 AAGAGAAGCAGTAAGTGTCCAGG - Intergenic
1024040766 7:45551789-45551811 AGGAGGAGCCCACAGTGGCCAGG - Intergenic
1024692642 7:51819541-51819563 ACAAGGAGCCCAAAATGACCAGG + Intergenic
1024744436 7:52390068-52390090 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1024834673 7:53502479-53502501 TAGAGTAGCCAAAAGTATCCAGG - Intergenic
1026046256 7:66907482-66907504 GGCAGGACCCCAAAGTGTCCAGG + Intergenic
1027406831 7:77871385-77871407 AGGGGGAGCCCAAAGTGTCCAGG + Intronic
1027474263 7:78609889-78609911 AGGAGGAGCCCAAAGTTTCCAGG + Intronic
1027546289 7:79531300-79531322 ATGAGGAGCCCAAAGTGGCGGGG + Intergenic
1027610339 7:80352286-80352308 AGGAGGAGCCCAAGGTGTCCAGG + Intergenic
1027686018 7:81279590-81279612 AGGAGGAGCCCAAAGTGGCCAGG - Intergenic
1027828113 7:83142431-83142453 GAGAGGAGCCCAAAGTTGACTGG - Intronic
1028044061 7:86093104-86093126 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1028141957 7:87283658-87283680 AGGAGGAGTCCGAAGTGTCAAGG - Intergenic
1028238098 7:88384770-88384792 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
1028698793 7:93751458-93751480 AAGAGCAGCACAAACTGTTCTGG - Intronic
1029333384 7:99878941-99878963 ATGAGGAGCCCCAAGTGGCATGG - Intronic
1030192531 7:106823867-106823889 ATGAGGAGCCCAAAGTGACTGGG + Intergenic
1030277775 7:107738276-107738298 AATAGGAGCCCAAAGTGTCCAGG - Intergenic
1030368984 7:108675685-108675707 AGGAGGAGGTCAAAGTATCCAGG - Intergenic
1030457234 7:109791422-109791444 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
1030506914 7:110436319-110436341 AGGAGGAGCCCGAAGTGGCCAGG - Intergenic
1030559295 7:111064717-111064739 AGGAGGAGCCCAAGGTGTCCAGG - Intronic
1030673816 7:112364727-112364749 ACAAGGAGCCCAAGGTGCCCAGG + Intergenic
1030883059 7:114904901-114904923 AGGAGGAGCCCAAAGTGTCCGGG + Intergenic
1030951186 7:115792297-115792319 ATGAGATGCCCAAAATGTCCTGG + Intergenic
1031237083 7:119189902-119189924 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1031474225 7:122203716-122203738 AAGAGGAGCTCAAAGTGTCCAGG + Intergenic
1031676764 7:124619919-124619941 AGGAGAAGCCCAAAGTATACAGG - Intergenic
1031767988 7:125805324-125805346 ATGAGGAGCTCAAAGTGGCCAGG - Intergenic
1031833237 7:126651659-126651681 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1031861296 7:126983092-126983114 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1031861360 7:126983536-126983558 AGGAGGAACCCCAAGTGTCCAGG - Intronic
1032152869 7:129445333-129445355 AGGAGGACCCCAAAGTGTCCAGG + Intronic
1032858088 7:135853565-135853587 ATGAGGAGCCCAAAGTGTCTGGG + Intergenic
1032923257 7:136574500-136574522 AGGAGGACCCCAAAGTGTCCAGG + Intergenic
1033392492 7:140941081-140941103 ATGAGGAGCCCAGAATGTCTGGG - Intergenic
1034170092 7:149056224-149056246 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1034357045 7:150459310-150459332 ATGAGGAGCCCAAAGTGGCCAGG + Intronic
1034696493 7:153058746-153058768 AAGAGGAGCCCACAGTCTGGTGG - Intergenic
1034783064 7:153899326-153899348 TAGAGGCGACCAAACTGTCCTGG - Intronic
1035719451 8:1780816-1780838 GAGAGGAGTCCATGGTGTCCAGG + Exonic
1035722989 8:1806359-1806381 AAGAGGAGGCAGAAGTGTTCAGG + Intergenic
1036527070 8:9545174-9545196 ATGAGGAGCTCAAAGTGGCTGGG + Intergenic
1037663141 8:20944111-20944133 AAGAGGAGCCCAGGGTCTCCTGG - Intergenic
1037675500 8:21047555-21047577 AGGAGGAGCCCAAAATGGCCAGG + Intergenic
1037740973 8:21608960-21608982 ATGAGGACCCCAAAATGACCAGG - Intergenic
1038425394 8:27461166-27461188 GAGATGAGCCCAAAGTGCCAGGG - Exonic
1038454230 8:27662014-27662036 ATAAGGAGCTCAAAGTGGCCAGG + Intronic
1038910733 8:31960742-31960764 AAGAGGAGTCCCAGGTGTCTGGG - Intronic
1039066157 8:33609908-33609930 AAGAGGAGCTCAAAGAGTCTTGG + Intergenic
1039140092 8:34377449-34377471 ACCAGGAGGCCAAGGTGTCCTGG - Intergenic
1039323961 8:36464909-36464931 AGGAGGAGCTCAAAGTGTCCAGG + Intergenic
1039527033 8:38226126-38226148 ATGAGGAGCCCAAAGTGGCTGGG + Intronic
1040793911 8:51268747-51268769 AAGAGGAGCCCAAAGTGGCCAGG + Intergenic
1041445452 8:57947008-57947030 AATAGGCGCCCAAGGTCTCCTGG + Intergenic
1041986408 8:63926113-63926135 AGAAGGAGCCAAAAGTGTCCAGG - Intergenic
1042000835 8:64122355-64122377 AGAAGGTGCCCAAAGTGTCCAGG + Intergenic
1042342633 8:67696011-67696033 ACCAGGAGCCCAAAGTGGCCAGG - Intronic
1042393730 8:68266092-68266114 AAGAGCAGCTCCAAGTGCCCTGG - Intergenic
1042958612 8:74278575-74278597 AGGAGGAACCCAAAGTGTGCAGG - Intronic
1043105503 8:76104788-76104810 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
1043163931 8:76879810-76879832 ATGAGGAGCCCAAAGTGGCCAGG + Intergenic
1043258235 8:78161809-78161831 AGGAGGAGCGGAAAGTGTCCAGG - Intergenic
1044151016 8:88774713-88774735 AGGAGGAGCCCAAAATGTCCAGG - Intergenic
1044202616 8:89454116-89454138 AGGAGGAGCCCAAAGTGTTCAGG - Intergenic
1044285749 8:90410801-90410823 AGGTGGAGCCCAAGGTGTCCAGG + Intergenic
1044486943 8:92765541-92765563 AAGAGGAGCCCAAAGTTTCCAGG + Intergenic
1044632918 8:94296770-94296792 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1045222000 8:100208205-100208227 AGGAGGAGCACAAAGTGTCCAGG - Intronic
1045436102 8:102166275-102166297 ATGAGGAGCACAAAGTGACTGGG + Intergenic
1046128423 8:109939731-109939753 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1046197781 8:110885843-110885865 AGGGAGAGCCCAAAGTGTCGAGG - Intergenic
1046417431 8:113936163-113936185 ATCAGGAGCCCAAAGTGTCCAGG + Intergenic
1046585556 8:116146094-116146116 AGGAGGAGCCCAAAGTGTCAAGG + Intergenic
1046718887 8:117596869-117596891 ACAAGGAGCCCAAAGTGATCTGG - Intergenic
1047085789 8:121513839-121513861 AAGAAAAGCACCAAGTGTCCTGG - Intergenic
1048943343 8:139422181-139422203 CTGAGGAGCTCAAAGTGTCCAGG - Intergenic
1049311468 8:141935995-141936017 AAAACGAGCCCAAAGTGACCCGG - Intergenic
1049538744 8:143195770-143195792 AGGAGGGGCTCAAAGTGTCCAGG - Intergenic
1050053111 9:1623544-1623566 AGGAGGAGCCCAAAGTGGCCAGG - Intergenic
1050144770 9:2555479-2555501 AAGAAGAGCCCAAATAGTCAAGG + Intergenic
1050173954 9:2850952-2850974 ACAAGGAGTCCAAAATGTCCAGG + Intergenic
1050482902 9:6104236-6104258 AGGAGGAGTCCAAAGTGTCCAGG - Intergenic
1050902053 9:10961553-10961575 AGGAGGAGCCCGAAGTGGCCAGG - Intergenic
1051882181 9:21850910-21850932 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1052227804 9:26110019-26110041 AGGAGGAGCCCAAAGTGTCCAGG - Exonic
1052561347 9:30088356-30088378 AGGAGAAGCCCAAAGTGTCCAGG + Intergenic
1052737107 9:32353928-32353950 AGGAGGTGCCCCAAGTGTCCAGG + Intergenic
1052895298 9:33741977-33741999 ATGAGGATCCCAAAGTGGCCAGG + Intergenic
1054195984 9:62032615-62032637 ATGAGTAACCCAAAGTGGCCAGG + Intergenic
1054642421 9:67556074-67556096 ATGAGTAACCCAAAGTGGCCAGG - Intergenic
1055103331 9:72487350-72487372 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1055903713 9:81269551-81269573 AGGAGGAACCCAAAGTGTGCAGG + Intergenic
1056156906 9:83846844-83846866 AGGTGGAGCCCAAAGTGTCCAGG - Intronic
1056240945 9:84646156-84646178 ATGAGGAACCCAAAGTGGCCAGG + Intergenic
1056314013 9:85371295-85371317 AGGAGGAGCCCACAGTGTCCAGG + Intergenic
1056353633 9:85776682-85776704 AGGTAGAGCCCAAAGTGTCCAGG + Intergenic
1057004725 9:91547163-91547185 CAGAGGAGCCCAAAGTGGCTGGG + Intergenic
1057059201 9:91988158-91988180 ATGAGGAACCCAAGGTGGCCAGG - Intergenic
1057100371 9:92353620-92353642 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1057720153 9:97525792-97525814 ATGAGGAGCCCAAAGTGGCCTGG + Intronic
1058124797 9:101179002-101179024 AGGAGAAGCCCAAAGTTTCCAGG - Intronic
1058543954 9:106041115-106041137 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1059196281 9:112374225-112374247 AGGAGGAGCACAAAATGTCCAGG + Intergenic
1059361490 9:113745262-113745284 AAGAAGAGACTCAAGTGTCCTGG - Intergenic
1061311808 9:129768407-129768429 ATGAGGAGCCCAAAGTGGCCGGG + Intergenic
1061645301 9:131996104-131996126 ACCAGGAGCCCAAAGTGCCCAGG - Intronic
1062724043 9:138061238-138061260 ACGAGCAGCCCCAAGTGACCAGG + Intronic
1186279737 X:7978755-7978777 AGAAGGAGCCCAAAGTGTCCTGG - Intergenic
1186469531 X:9810496-9810518 AGGAGGAGCCCAAAGCACCCAGG + Intronic
1187323202 X:18260469-18260491 CAGAGGACCACAAACTGTCCAGG + Intronic
1187524139 X:20038745-20038767 AGGAGGAGCTTAAAGTGTCCAGG - Intronic
1188234159 X:27706280-27706302 AAAAGGAGCCCAAATAGCCCAGG - Intronic
1189032258 X:37462689-37462711 ATGAGGAGCACAAAGTGGCCAGG + Intronic
1189596622 X:42573316-42573338 AGGAGGAGCTCAAAGTGGCCAGG - Intergenic
1190155219 X:47985871-47985893 AGGAGGAGCCCAAAGTAGCCAGG - Intronic
1190527653 X:51344266-51344288 ATGAGGATCCCAAAGTGGCCAGG + Intergenic
1190996380 X:55614471-55614493 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1190996532 X:55615847-55615869 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1191658578 X:63628168-63628190 AGGAAGAGCCCAAAGTGTCCAGG + Intergenic
1191719023 X:64214080-64214102 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1191759573 X:64631535-64631557 AGGAGGAGCTCAAAGTGTCCAGG - Intergenic
1191769281 X:64738455-64738477 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1191933131 X:66395789-66395811 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1191946568 X:66540660-66540682 TGGAGGAGCCCAAAGTGTCCTGG - Intergenic
1191988150 X:67004223-67004245 AGGAGAAACCCAAAGTGGCCAGG + Intergenic
1192027781 X:67473441-67473463 AAGAGGAAGTCAAATTGTCCCGG + Intergenic
1192297486 X:69866382-69866404 AGGAGGAGCCTAAAGTGTCCAGG + Intronic
1192673038 X:73166768-73166790 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1192891251 X:75393209-75393231 AGGAGGAGCCCAAAATGTTCAGG + Intronic
1192898923 X:75473531-75473553 AGGAGGAGCCCAAACTGTCCAGG - Intronic
1192996398 X:76517218-76517240 AAGAGGGGCCCAAAGTGGCCAGG - Intergenic
1193053716 X:77127404-77127426 GGTAGGAGCCCAAAGTGGCCAGG - Intergenic
1193288151 X:79737849-79737871 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1193356466 X:80524779-80524801 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1193447388 X:81620404-81620426 AGGAGGAGCCCAAAGTGGCCAGG - Intergenic
1193833176 X:86311744-86311766 AGGAAGAGCCCAAAGTGTCCAGG - Intronic
1193841331 X:86412129-86412151 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1193904690 X:87227461-87227483 AGGAGGAGCTCAAAGTGTCCCGG - Intergenic
1193905465 X:87238286-87238308 AAGAGGAGCCCAAAGTGTCCAGG + Intergenic
1193979104 X:88159058-88159080 AGGAGGACCCCAAAGTTACCAGG - Intergenic
1194140627 X:90204540-90204562 ATGAGGAGCCCAAAGTGGCCAGG + Intergenic
1194174843 X:90632467-90632489 AGGGGGAGCCCAAAGTGTCCAGG - Intergenic
1194179382 X:90694294-90694316 AGGAGAAGTGCAAAGTGTCCAGG + Intergenic
1194210506 X:91063985-91064007 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1194233074 X:91347921-91347943 AGGAGGAGCTCAAAGTGGCCAGG - Intergenic
1194277213 X:91900229-91900251 AGGAGGAGCCCAGAGTGGCCAGG + Intronic
1194457174 X:94119114-94119136 AGCAGGAGCCCAAAGTGTCCAGG - Intergenic
1194485323 X:94478930-94478952 AGGAGGAGCCCAAAGTGTCTAGG - Intergenic
1194513207 X:94820628-94820650 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1194584341 X:95714701-95714723 AGGAGGAGCCCAAAGTTTCCAGG - Intergenic
1194626785 X:96234623-96234645 ATGAGGAGTACAAAGTGGCCAGG - Intergenic
1194651844 X:96524519-96524541 AAAAGGAGCCAAAAGTATTCTGG + Intergenic
1195013420 X:100755109-100755131 ATGAGGAGCCCAAAGTGGTCAGG + Intergenic
1195097151 X:101514089-101514111 ATGAGAAGCCCAAAGTGGCCTGG + Intronic
1195748687 X:108143607-108143629 AAGAGGAGCCCAAAGTGTCCAGG + Intronic
1195782121 X:108478234-108478256 AGGAGGGGCCCAAAGTGTCCAGG + Intronic
1196372452 X:114994944-114994966 AGGAGGATCCCAAAGTGTCAAGG + Intergenic
1196585520 X:117422957-117422979 AGGAGGAGACCAAAGTGTCCAGG - Intergenic
1196605333 X:117651230-117651252 AGAAGGAGCCCAAAGTATCCAGG - Intergenic
1197044629 X:121979949-121979971 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1197062644 X:122199602-122199624 AGGAGGAGCCAAAGGTGGCCAGG + Intergenic
1197084023 X:122452055-122452077 AGGAGGAGCCCAAAGTAACTAGG + Intergenic
1197182324 X:123549416-123549438 AGGAGGAGCCCAAAGTGTCTGGG - Intergenic
1197244822 X:124157359-124157381 AGGAGGAGCCCTAAGTGTCCGGG + Intronic
1197371832 X:125636227-125636249 AGGAGGAGCCTAAAGTGGCCAGG + Intergenic
1197396098 X:125929315-125929337 AAGAGGAAGTCAAATTGTCCCGG - Intergenic
1197405385 X:126041836-126041858 AGGAGGTGCCCAAAGTGTCCAGG - Intergenic
1197409118 X:126094824-126094846 AAGAGGAGCCCAAAGTGTCCAGG + Intergenic
1197420106 X:126227972-126227994 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1197420427 X:126231407-126231429 AAGAGGAAGTCAAATTGTCCCGG - Intergenic
1197477162 X:126939924-126939946 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1197501026 X:127242782-127242804 ATGAGGAGCCCACGTTGTCCAGG - Intergenic
1197522152 X:127511927-127511949 ATGAGTAGCCCAAAGTGACCAGG - Intergenic
1197592096 X:128421027-128421049 AGGAGGAGCCCAAAGTGTGCAGG - Intergenic
1197988798 X:132295237-132295259 ATGAGGAGCCCAAAGTGGCCAGG + Intergenic
1198170264 X:134098351-134098373 CAGAGGAGCCCAAAGTGGCCAGG - Intergenic
1198185974 X:134254414-134254436 ACAAGGAGCCCAAAGTGTCCAGG + Intergenic
1198307095 X:135394098-135394120 AGGAGGAGCCCAAAGCGTCCAGG - Intergenic
1198412273 X:136382798-136382820 AGGAGGAACCCAAAGTGTCCAGG + Intronic
1198757305 X:139995229-139995251 ACGAGGAATCCAAAGTGCCCTGG - Intergenic
1198934260 X:141889489-141889511 AGGACGAGCCCAGAGTGTCCAGG - Intronic
1199013340 X:142782304-142782326 ATGAGGAGCCCAAAGTGTCTGGG - Intergenic
1199116350 X:143997630-143997652 AGGAGGAGCCCAATGTGTCCAGG + Intergenic
1199144237 X:144347333-144347355 AGGAGAAGCCCAAAGTGTCCAGG + Intergenic
1200087855 X:153618520-153618542 AAGGGGAGTACAAACTGTCCAGG - Intergenic
1200486393 Y:3773666-3773688 ATGAGGAGCCCAAAGTGGCCAGG + Intergenic
1200521492 Y:4213657-4213679 AGGGGGAGCCCAGAGTGTCCAGG - Intergenic
1200526048 Y:4276467-4276489 AGGAGAAGTGCAAAGTGTCCAGG + Intergenic
1200594556 Y:5122328-5122350 AGGAGGAGCCCAGAGTGGCCAGG + Intronic
1200745830 Y:6903234-6903256 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1201529448 Y:14976267-14976289 TGTAGGAGCCCAAAGTGTCCAGG + Intergenic
1201796473 Y:17901994-17902016 AGGAGGAGGCCCAAGTGTCCAGG + Intergenic
1201805082 Y:18003991-18004013 AGGAGGAGGCCCAAGTGTCCAGG - Intergenic
1202134398 Y:21646779-21646801 AGGAGGAGCCCAAAGTGATAAGG + Intergenic
1202200410 Y:22341561-22341583 AAGAGGAAGTCAAATTGTCCCGG - Intronic
1202357856 Y:24071058-24071080 AGGAGGAGGCCCAAGTGTCCAGG + Intergenic
1202512922 Y:25599055-25599077 AGGAGGAGGCCCAAGTGTCCAGG - Intergenic