ID: 1020567548

View in Genome Browser
Species Human (GRCh38)
Location 7:9817218-9817240
Sequence GGAGCCCAAAGTGTCCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020567539_1020567548 27 Left 1020567539 7:9817168-9817190 CCCAGCCAACGCTGTAACTCCCT No data
Right 1020567548 7:9817218-9817240 GGAGCCCAAAGTGTCCAGGTAGG No data
1020567542_1020567548 8 Left 1020567542 7:9817187-9817209 CCCTTATTAGCCTGTTTTCTTAA No data
Right 1020567548 7:9817218-9817240 GGAGCCCAAAGTGTCCAGGTAGG No data
1020567545_1020567548 -2 Left 1020567545 7:9817197-9817219 CCTGTTTTCTTAAAGGTAAGAGG No data
Right 1020567548 7:9817218-9817240 GGAGCCCAAAGTGTCCAGGTAGG No data
1020567543_1020567548 7 Left 1020567543 7:9817188-9817210 CCTTATTAGCCTGTTTTCTTAAA No data
Right 1020567548 7:9817218-9817240 GGAGCCCAAAGTGTCCAGGTAGG No data
1020567538_1020567548 28 Left 1020567538 7:9817167-9817189 CCCCAGCCAACGCTGTAACTCCC No data
Right 1020567548 7:9817218-9817240 GGAGCCCAAAGTGTCCAGGTAGG No data
1020567541_1020567548 22 Left 1020567541 7:9817173-9817195 CCAACGCTGTAACTCCCTTATTA No data
Right 1020567548 7:9817218-9817240 GGAGCCCAAAGTGTCCAGGTAGG No data
1020567540_1020567548 26 Left 1020567540 7:9817169-9817191 CCAGCCAACGCTGTAACTCCCTT No data
Right 1020567548 7:9817218-9817240 GGAGCCCAAAGTGTCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020567548 Original CRISPR GGAGCCCAAAGTGTCCAGGT AGG Intergenic
No off target data available for this crispr