ID: 1020567550

View in Genome Browser
Species Human (GRCh38)
Location 7:9817222-9817244
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020567550_1020567553 -4 Left 1020567550 7:9817222-9817244 CCCAAAGTGTCCAGGTAGGGATC No data
Right 1020567553 7:9817241-9817263 GATCTTAACTTCCAGTTTAATGG No data
1020567550_1020567556 20 Left 1020567550 7:9817222-9817244 CCCAAAGTGTCCAGGTAGGGATC No data
Right 1020567556 7:9817265-9817287 ATCACTGTTGTGTCTCCTGGTGG No data
1020567550_1020567555 17 Left 1020567550 7:9817222-9817244 CCCAAAGTGTCCAGGTAGGGATC No data
Right 1020567555 7:9817262-9817284 GGAATCACTGTTGTGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020567550 Original CRISPR GATCCCTACCTGGACACTTT GGG (reversed) Intergenic
No off target data available for this crispr