ID: 1020567553

View in Genome Browser
Species Human (GRCh38)
Location 7:9817241-9817263
Sequence GATCTTAACTTCCAGTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020567551_1020567553 -5 Left 1020567551 7:9817223-9817245 CCAAAGTGTCCAGGTAGGGATCT No data
Right 1020567553 7:9817241-9817263 GATCTTAACTTCCAGTTTAATGG No data
1020567545_1020567553 21 Left 1020567545 7:9817197-9817219 CCTGTTTTCTTAAAGGTAAGAGG No data
Right 1020567553 7:9817241-9817263 GATCTTAACTTCCAGTTTAATGG No data
1020567550_1020567553 -4 Left 1020567550 7:9817222-9817244 CCCAAAGTGTCCAGGTAGGGATC No data
Right 1020567553 7:9817241-9817263 GATCTTAACTTCCAGTTTAATGG No data
1020567543_1020567553 30 Left 1020567543 7:9817188-9817210 CCTTATTAGCCTGTTTTCTTAAA No data
Right 1020567553 7:9817241-9817263 GATCTTAACTTCCAGTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020567553 Original CRISPR GATCTTAACTTCCAGTTTAA TGG Intergenic
No off target data available for this crispr