ID: 1020571472

View in Genome Browser
Species Human (GRCh38)
Location 7:9868831-9868853
Sequence GAACCCCCATTGGCCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020571470_1020571472 14 Left 1020571470 7:9868794-9868816 CCAAAATAACGGAGGCATAGTAG No data
Right 1020571472 7:9868831-9868853 GAACCCCCATTGGCCAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020571472 Original CRISPR GAACCCCCATTGGCCAAAAC TGG Intergenic
No off target data available for this crispr