ID: 1020574935

View in Genome Browser
Species Human (GRCh38)
Location 7:9913997-9914019
Sequence AGGGAGAGTGTAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020574935_1020574940 14 Left 1020574935 7:9913997-9914019 CCCACAATCACTACACTCTCCCT No data
Right 1020574940 7:9914034-9914056 GATTCTCTCTCTGTGCCATGTGG No data
1020574935_1020574942 27 Left 1020574935 7:9913997-9914019 CCCACAATCACTACACTCTCCCT No data
Right 1020574942 7:9914047-9914069 TGCCATGTGGCCACTGCTGAGGG No data
1020574935_1020574941 26 Left 1020574935 7:9913997-9914019 CCCACAATCACTACACTCTCCCT No data
Right 1020574941 7:9914046-9914068 GTGCCATGTGGCCACTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020574935 Original CRISPR AGGGAGAGTGTAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr