ID: 1020577176

View in Genome Browser
Species Human (GRCh38)
Location 7:9947706-9947728
Sequence TTCATCACTGCTGAGTAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020577173_1020577176 8 Left 1020577173 7:9947675-9947697 CCCTGACGGGACAAACATAGTTC No data
Right 1020577176 7:9947706-9947728 TTCATCACTGCTGAGTAAAGTGG No data
1020577172_1020577176 14 Left 1020577172 7:9947669-9947691 CCACTGCCCTGACGGGACAAACA No data
Right 1020577176 7:9947706-9947728 TTCATCACTGCTGAGTAAAGTGG No data
1020577174_1020577176 7 Left 1020577174 7:9947676-9947698 CCTGACGGGACAAACATAGTTCT No data
Right 1020577176 7:9947706-9947728 TTCATCACTGCTGAGTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020577176 Original CRISPR TTCATCACTGCTGAGTAAAG TGG Intergenic
No off target data available for this crispr