ID: 1020578133

View in Genome Browser
Species Human (GRCh38)
Location 7:9960307-9960329
Sequence TCATTCACACACATGGCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020578130_1020578133 -9 Left 1020578130 7:9960293-9960315 CCAATCCATAGCTGTCATTCACA No data
Right 1020578133 7:9960307-9960329 TCATTCACACACATGGCTCGTGG No data
1020578129_1020578133 15 Left 1020578129 7:9960269-9960291 CCTGAGAAGGAGGGCAGCATGCT No data
Right 1020578133 7:9960307-9960329 TCATTCACACACATGGCTCGTGG No data
1020578127_1020578133 24 Left 1020578127 7:9960260-9960282 CCATCTCTTCCTGAGAAGGAGGG No data
Right 1020578133 7:9960307-9960329 TCATTCACACACATGGCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020578133 Original CRISPR TCATTCACACACATGGCTCG TGG Intergenic
No off target data available for this crispr