ID: 1020579406

View in Genome Browser
Species Human (GRCh38)
Location 7:9976068-9976090
Sequence CTGTGAAAGGCCAAGGTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020579406_1020579411 -8 Left 1020579406 7:9976068-9976090 CCGCTCACCTTGGCCTTTCACAG No data
Right 1020579411 7:9976083-9976105 TTTCACAGTGCTGGGATTACAGG 0: 11
1: 841
2: 25493
3: 326815
4: 260072

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020579406 Original CRISPR CTGTGAAAGGCCAAGGTGAG CGG (reversed) Intergenic
No off target data available for this crispr