ID: 1020580110

View in Genome Browser
Species Human (GRCh38)
Location 7:9987226-9987248
Sequence GCACCATGTTGTGATGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020580105_1020580110 25 Left 1020580105 7:9987178-9987200 CCTCAGGTTTTCCCCTCTTTGCA No data
Right 1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG No data
1020580108_1020580110 12 Left 1020580108 7:9987191-9987213 CCTCTTTGCACATGTCCACTCTC No data
Right 1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG No data
1020580107_1020580110 13 Left 1020580107 7:9987190-9987212 CCCTCTTTGCACATGTCCACTCT No data
Right 1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG No data
1020580104_1020580110 26 Left 1020580104 7:9987177-9987199 CCCTCAGGTTTTCCCCTCTTTGC No data
Right 1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG No data
1020580106_1020580110 14 Left 1020580106 7:9987189-9987211 CCCCTCTTTGCACATGTCCACTC No data
Right 1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG No data
1020580109_1020580110 -3 Left 1020580109 7:9987206-9987228 CCACTCTCTTTTGACTTTTTGCA No data
Right 1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020580110 Original CRISPR GCACCATGTTGTGATGCAAC AGG Intergenic
No off target data available for this crispr