ID: 1020587554

View in Genome Browser
Species Human (GRCh38)
Location 7:10088135-10088157
Sequence GGACACACTGTTCCAAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020587551_1020587554 17 Left 1020587551 7:10088095-10088117 CCAATGCATGTAGAAGAAGGAAG No data
Right 1020587554 7:10088135-10088157 GGACACACTGTTCCAAAAGATGG No data
1020587547_1020587554 25 Left 1020587547 7:10088087-10088109 CCCTCCTGCCAATGCATGTAGAA No data
Right 1020587554 7:10088135-10088157 GGACACACTGTTCCAAAAGATGG No data
1020587548_1020587554 24 Left 1020587548 7:10088088-10088110 CCTCCTGCCAATGCATGTAGAAG No data
Right 1020587554 7:10088135-10088157 GGACACACTGTTCCAAAAGATGG No data
1020587549_1020587554 21 Left 1020587549 7:10088091-10088113 CCTGCCAATGCATGTAGAAGAAG No data
Right 1020587554 7:10088135-10088157 GGACACACTGTTCCAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020587554 Original CRISPR GGACACACTGTTCCAAAAGA TGG Intergenic
No off target data available for this crispr