ID: 1020597300

View in Genome Browser
Species Human (GRCh38)
Location 7:10223771-10223793
Sequence CCACTTTGGAAGTGGAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020597300_1020597307 9 Left 1020597300 7:10223771-10223793 CCTGGTCTCCACTTCCAAAGTGG No data
Right 1020597307 7:10223803-10223825 CCCTGAATTCTCTGGAAGAGAGG No data
1020597300_1020597309 29 Left 1020597300 7:10223771-10223793 CCTGGTCTCCACTTCCAAAGTGG No data
Right 1020597309 7:10223823-10223845 AGGAACTTTGTGTCCTCACGTGG No data
1020597300_1020597304 1 Left 1020597300 7:10223771-10223793 CCTGGTCTCCACTTCCAAAGTGG No data
Right 1020597304 7:10223795-10223817 GCCTTTAACCCTGAATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020597300 Original CRISPR CCACTTTGGAAGTGGAGACC AGG (reversed) Intergenic
No off target data available for this crispr