ID: 1020601561

View in Genome Browser
Species Human (GRCh38)
Location 7:10280733-10280755
Sequence CTGAGTCTACAAATCTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020601561_1020601569 28 Left 1020601561 7:10280733-10280755 CCAATATAGATTTGTAGACTCAG No data
Right 1020601569 7:10280784-10280806 GGTCAAGATGTGGAGGAGACAGG No data
1020601561_1020601568 21 Left 1020601561 7:10280733-10280755 CCAATATAGATTTGTAGACTCAG No data
Right 1020601568 7:10280777-10280799 TAAGCAAGGTCAAGATGTGGAGG No data
1020601561_1020601565 -6 Left 1020601561 7:10280733-10280755 CCAATATAGATTTGTAGACTCAG No data
Right 1020601565 7:10280750-10280772 ACTCAGAGGTAGGCAAGGCTTGG No data
1020601561_1020601567 18 Left 1020601561 7:10280733-10280755 CCAATATAGATTTGTAGACTCAG No data
Right 1020601567 7:10280774-10280796 AAGTAAGCAAGGTCAAGATGTGG No data
1020601561_1020601566 7 Left 1020601561 7:10280733-10280755 CCAATATAGATTTGTAGACTCAG No data
Right 1020601566 7:10280763-10280785 CAAGGCTTGGAAAGTAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020601561 Original CRISPR CTGAGTCTACAAATCTATAT TGG (reversed) Intergenic
No off target data available for this crispr