ID: 1020605011

View in Genome Browser
Species Human (GRCh38)
Location 7:10326413-10326435
Sequence TGTCCCTCCATTATAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020605007_1020605011 11 Left 1020605007 7:10326379-10326401 CCTGATTCAAATACAGATATATA No data
Right 1020605011 7:10326413-10326435 TGTCCCTCCATTATAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020605011 Original CRISPR TGTCCCTCCATTATAGAGGA GGG Intergenic
No off target data available for this crispr