ID: 1020605895

View in Genome Browser
Species Human (GRCh38)
Location 7:10336402-10336424
Sequence CAGGTAAATTATACATTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020605894_1020605895 -8 Left 1020605894 7:10336387-10336409 CCATATACGGATGGTCAGGTAAA No data
Right 1020605895 7:10336402-10336424 CAGGTAAATTATACATTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020605895 Original CRISPR CAGGTAAATTATACATTTGC AGG Intergenic
No off target data available for this crispr