ID: 1020605895 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:10336402-10336424 |
| Sequence | CAGGTAAATTATACATTTGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1020605894_1020605895 | -8 | Left | 1020605894 | 7:10336387-10336409 | CCATATACGGATGGTCAGGTAAA | No data | ||
| Right | 1020605895 | 7:10336402-10336424 | CAGGTAAATTATACATTTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1020605895 | Original CRISPR | CAGGTAAATTATACATTTGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||