ID: 1020618386

View in Genome Browser
Species Human (GRCh38)
Location 7:10488769-10488791
Sequence GTTGAATCACTATCAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020618386_1020618388 -3 Left 1020618386 7:10488769-10488791 CCTGTGTTTGATAGTGATTCAAC No data
Right 1020618388 7:10488789-10488811 AACATGATATTTGTAAAAGAGGG No data
1020618386_1020618387 -4 Left 1020618386 7:10488769-10488791 CCTGTGTTTGATAGTGATTCAAC No data
Right 1020618387 7:10488788-10488810 CAACATGATATTTGTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020618386 Original CRISPR GTTGAATCACTATCAAACAC AGG (reversed) Intergenic
No off target data available for this crispr