ID: 1020632511

View in Genome Browser
Species Human (GRCh38)
Location 7:10656617-10656639
Sequence CAGAGAACTAAGAAGGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020632506_1020632511 6 Left 1020632506 7:10656588-10656610 CCCTAGAACAGGAAGAATCTCTG No data
Right 1020632511 7:10656617-10656639 CAGAGAACTAAGAAGGCGGGTGG No data
1020632507_1020632511 5 Left 1020632507 7:10656589-10656611 CCTAGAACAGGAAGAATCTCTGC No data
Right 1020632511 7:10656617-10656639 CAGAGAACTAAGAAGGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020632511 Original CRISPR CAGAGAACTAAGAAGGCGGG TGG Intergenic
No off target data available for this crispr