ID: 1020634522

View in Genome Browser
Species Human (GRCh38)
Location 7:10680336-10680358
Sequence AGCATTGGAATACTGATGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020634522_1020634527 4 Left 1020634522 7:10680336-10680358 CCTATCATCAGTATTCCAATGCT No data
Right 1020634527 7:10680363-10680385 TTGAAGTCAGGGGAAAAAATAGG No data
1020634522_1020634524 -8 Left 1020634522 7:10680336-10680358 CCTATCATCAGTATTCCAATGCT No data
Right 1020634524 7:10680351-10680373 CCAATGCTCAAATTGAAGTCAGG No data
1020634522_1020634526 -6 Left 1020634522 7:10680336-10680358 CCTATCATCAGTATTCCAATGCT No data
Right 1020634526 7:10680353-10680375 AATGCTCAAATTGAAGTCAGGGG No data
1020634522_1020634525 -7 Left 1020634522 7:10680336-10680358 CCTATCATCAGTATTCCAATGCT No data
Right 1020634525 7:10680352-10680374 CAATGCTCAAATTGAAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020634522 Original CRISPR AGCATTGGAATACTGATGAT AGG (reversed) Intergenic
No off target data available for this crispr