ID: 1020635769

View in Genome Browser
Species Human (GRCh38)
Location 7:10694169-10694191
Sequence CTCCAAATGATACTGGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020635769_1020635772 2 Left 1020635769 7:10694169-10694191 CCTGAAACCAGTATCATTTGGAG No data
Right 1020635772 7:10694194-10694216 ATTAGAAATGAAAATTATTAGGG No data
1020635769_1020635771 1 Left 1020635769 7:10694169-10694191 CCTGAAACCAGTATCATTTGGAG No data
Right 1020635771 7:10694193-10694215 AATTAGAAATGAAAATTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020635769 Original CRISPR CTCCAAATGATACTGGTTTC AGG (reversed) Intergenic
No off target data available for this crispr