ID: 1020644241

View in Genome Browser
Species Human (GRCh38)
Location 7:10794752-10794774
Sequence TCATTGAGACTATTCTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020644238_1020644241 -5 Left 1020644238 7:10794734-10794756 CCAATCTTATCCACTTTTTCATT No data
Right 1020644241 7:10794752-10794774 TCATTGAGACTATTCTGGAATGG No data
1020644237_1020644241 -4 Left 1020644237 7:10794733-10794755 CCCAATCTTATCCACTTTTTCAT No data
Right 1020644241 7:10794752-10794774 TCATTGAGACTATTCTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020644241 Original CRISPR TCATTGAGACTATTCTGGAA TGG Intergenic
No off target data available for this crispr