ID: 1020647225

View in Genome Browser
Species Human (GRCh38)
Location 7:10829519-10829541
Sequence ATGGCCTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020647225_1020647228 2 Left 1020647225 7:10829519-10829541 CCTTCACTCTTCTAGAAGGCCAT No data
Right 1020647228 7:10829544-10829566 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254
1020647225_1020647229 7 Left 1020647225 7:10829519-10829541 CCTTCACTCTTCTAGAAGGCCAT No data
Right 1020647229 7:10829549-10829571 TAGGTCCTTTTTCCATGGTTTGG 0: 14
1: 15
2: 18
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020647225 Original CRISPR ATGGCCTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr